ID: 966377517

View in Genome Browser
Species Human (GRCh38)
Location 3:179312090-179312112
Sequence CAATTTAGGCTGAGCGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966377517_966377523 20 Left 966377517 3:179312090-179312112 CCCGCCACGCTCAGCCTAAATTG No data
Right 966377523 3:179312133-179312155 CAGTGAGAAGTGAGAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966377517 Original CRISPR CAATTTAGGCTGAGCGTGGC GGG (reversed) Intergenic
No off target data available for this crispr