ID: 966379198

View in Genome Browser
Species Human (GRCh38)
Location 3:179326210-179326232
Sequence AATCCCAGCCTCCTGCTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966379189_966379198 29 Left 966379189 3:179326158-179326180 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG 0: 1
1: 0
2: 1
3: 34
4: 271
966379188_966379198 30 Left 966379188 3:179326157-179326179 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG 0: 1
1: 0
2: 1
3: 34
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966379198 Original CRISPR AATCCCAGCCTCCTGCTGGC GGG Intronic
903427088 1:23261960-23261982 ACTACCAGCTTCCTGATGGCGGG - Intergenic
903675966 1:25064880-25064902 AAGCCCACCTTCCTGCTGGGTGG + Intergenic
903771441 1:25766908-25766930 TGGCCCAGCCTCCTGCTGCCAGG + Intronic
903968665 1:27105121-27105143 ACTCCAGGCCTCCTGCTGCCTGG + Intronic
906214944 1:44033227-44033249 CACCCCAGCCTACTGCTGGAAGG - Intergenic
907573780 1:55507447-55507469 AGCCCCAGCCTACTGCTGCCAGG - Intergenic
908001431 1:59684159-59684181 ATTCCCAGTCTACTGGTGGCGGG + Intronic
908114331 1:60925954-60925976 AATTCCACCCTCCTTCTGGCAGG - Intronic
909404142 1:75267662-75267684 CATCTCAGCCTCCTGATAGCTGG + Intronic
911274146 1:95840490-95840512 TTTCCCACCCACCTGCTGGCAGG - Intergenic
912358605 1:109075963-109075985 ACTCACAGCGTCCTGCCGGCTGG + Exonic
915322694 1:155064248-155064270 ATCCCCAGCCTCCCGCAGGCTGG + Intronic
915527093 1:156482696-156482718 AGTCCCAGCCTACAGATGGCTGG + Intronic
919765826 1:201126907-201126929 GAGCCAAGCCACCTGCTGGCTGG - Intronic
920038064 1:203078170-203078192 ACTCCCAGCAACCTGATGGCAGG - Exonic
920255527 1:204651850-204651872 AACCCCATCCTCCTGCTGTAGGG + Intronic
920369198 1:205467033-205467055 GCTCCCAGCCTCCAGCTTGCTGG - Intergenic
920513420 1:206567201-206567223 AAGCCCTGGCACCTGCTGGCAGG + Intronic
920571749 1:207022960-207022982 AACCCCAGCCTCCTCCTGCAGGG - Exonic
920932952 1:210406081-210406103 ACTCCCACCCTCCTCCTGGAGGG - Intronic
920963569 1:210684243-210684265 AGCCCCAGCCTCTTGGTGGCAGG - Intronic
922288627 1:224191470-224191492 AATCCCAGCATCATTCTGGAAGG - Intronic
922612440 1:226940378-226940400 GATCCCAGCTTCCTGCAGCCAGG + Intronic
922795748 1:228338617-228338639 CCTCCCAGCCTCGTGCTGGCAGG + Intronic
923105659 1:230851484-230851506 ACTCCCTGCCTCCTCCTGTCTGG + Intronic
924741456 1:246796472-246796494 CATCCCAGCCACCTGGTGACAGG - Intergenic
1062871152 10:905825-905847 AGAACCAGCCTCCTGCTTGCTGG + Intronic
1063237641 10:4135008-4135030 GTTCCCAGCCTCTTGCTTGCTGG - Intergenic
1064983554 10:21187876-21187898 AATCCCATCATACTTCTGGCAGG - Intergenic
1065092703 10:22251792-22251814 AACCCGAGCCTCCTCCTGGGCGG + Intergenic
1066007320 10:31157675-31157697 AGCCTCAGCCTCCTTCTGGCGGG + Intergenic
1067081023 10:43212252-43212274 GCTCCCAGCCTCCTGCTGCCCGG + Intronic
1067107524 10:43375951-43375973 TATCCCAGACTCTTGCTGCCCGG - Intronic
1070809106 10:79288692-79288714 ATCCCCAGCCTCCTGGGGGCTGG + Intronic
1071436752 10:85654645-85654667 TATCACAGCCTCCTCATGGCTGG - Intronic
1071553477 10:86585132-86585154 AGGCTCAGCCTGCTGCTGGCTGG + Intergenic
1071819471 10:89265027-89265049 CATGCCAGCCCCCTGCTGCCTGG - Intronic
1072306340 10:94111242-94111264 AATCCCACCCTGCAGCTGGAAGG - Intronic
1073812814 10:107169345-107169367 AATCCCATCATTCTGTTGGCAGG - Intergenic
1074140309 10:110666676-110666698 GATCTCAGCCTCCTACTTGCTGG - Intronic
1076123428 10:127954332-127954354 TCTGCCAGCCTCCTGGTGGCAGG + Intronic
1076686156 10:132199363-132199385 AGTGCCAGGCTCCAGCTGGCTGG - Intronic
1076738862 10:132471216-132471238 TTTCCCAGCTGCCTGCTGGCTGG + Intergenic
1076924345 10:133474877-133474899 AATTCCATCCTCCTGCAGGGAGG + Intergenic
1076989515 11:264049-264071 AATCCCAGCTCCATGGTGGCTGG + Intergenic
1077004492 11:346463-346485 TCTCCCAGCCTCCTGCAGCCTGG + Intergenic
1077135446 11:995834-995856 AATTCAAGCCTCCAGATGGCGGG - Intronic
1077147211 11:1051659-1051681 AGGCCCAGCTTCCTGCTGGGGGG - Intergenic
1077250730 11:1559536-1559558 CCTCCCTGCCTCCAGCTGGCTGG + Intronic
1077491183 11:2861767-2861789 AGTCCCGGCCTCCTGCTCCCCGG + Intergenic
1077888988 11:6405332-6405354 AAGCCCAGCCTCAAGCTTGCTGG - Intronic
1079688397 11:23391659-23391681 AATCCCCTCCTCCTTCTGGCAGG - Intergenic
1083279956 11:61620784-61620806 AATGCCAGCCTCCTGGAGGTAGG + Intergenic
1083783654 11:64931631-64931653 CCTCCCAGCCTCCCTCTGGCGGG - Intronic
1084296065 11:68213907-68213929 GATCCCAGCCGCCTACCGGCCGG - Intergenic
1084448307 11:69217245-69217267 AATCCAAGGTTCCTGCTGGAAGG - Intergenic
1084659892 11:70540475-70540497 ACTCCCAGGCTCCCGCGGGCAGG - Intronic
1084729510 11:71064438-71064460 CATCCCAGCTTGCTGCTGCCTGG - Intronic
1084777274 11:71385816-71385838 CAACCCAGCCACATGCTGGCAGG + Intergenic
1085448755 11:76618056-76618078 AATCCCACCCTCCCACTGTCTGG - Intergenic
1085644308 11:78213265-78213287 AAGCCCATCCTCCTGCTACCAGG - Intronic
1086375272 11:86193904-86193926 AATCCCATCCTACTGCTTGGAGG + Intergenic
1086377693 11:86217882-86217904 AATTCCAGACTTCTGCTGGCAGG + Intergenic
1086863036 11:91947599-91947621 TTTCCCAGCTTTCTGCTGGCAGG + Intergenic
1088846308 11:113671265-113671287 AATCCCACCTTCCTTCTGTCTGG + Intergenic
1089116173 11:116096970-116096992 AATCCCAGCTTCTTGCTGGGTGG - Intergenic
1089708763 11:120299931-120299953 CTTCCCAGCCTCCTGTTGGGTGG + Intronic
1090302021 11:125650679-125650701 AATCCCAGCCACCTGAGGTCAGG - Intronic
1091712628 12:2752747-2752769 AGCCCCAGCCTCCTGGCGGCCGG - Intergenic
1099232059 12:80038395-80038417 AGTCACAGTCTCCTGCAGGCTGG - Intergenic
1100631974 12:96399376-96399398 CAGGGCAGCCTCCTGCTGGCGGG - Intronic
1101066179 12:101023555-101023577 CATCTCAGCCTCCTGATGGCTGG - Intronic
1104952263 12:132446594-132446616 AACTCCAGTCTCCTGCTAGCTGG + Intergenic
1107951272 13:45464674-45464696 GATCCAAGTCTCCTGCCGGCAGG + Intergenic
1108059350 13:46517309-46517331 CATCCCAGTCTCATCCTGGCAGG + Intergenic
1110541629 13:76712937-76712959 TATCCCATCATCCTTCTGGCAGG - Intergenic
1112746266 13:102530714-102530736 AATCTCAGCCCCATGCTGGCTGG + Intergenic
1112785048 13:102942548-102942570 CTTCCCTGCTTCCTGCTGGCTGG + Intergenic
1112843287 13:103606378-103606400 ATTAACAGCCTCCTGCTGGAGGG - Intergenic
1114265740 14:21071551-21071573 AGACCCAGCCTCCTGCCGGCGGG - Intronic
1115233609 14:31187234-31187256 AGTCCCAGCTCCCTGCTGGGAGG + Intronic
1116824626 14:49660633-49660655 AATCCCAGCCTCCCTCTGGGAGG + Intronic
1121113301 14:91327269-91327291 AATCCAAGACTCCTGGTGGAGGG + Intronic
1121218146 14:92264369-92264391 TTTCCCAGCCTCCTGCTGGGTGG - Intergenic
1122322828 14:100865963-100865985 AAGCATAACCTCCTGCTGGCTGG - Intergenic
1122347274 14:101068349-101068371 AATCTCAGCCTCATCCTGGAAGG - Intergenic
1122634585 14:103123973-103123995 CCCCCCAGCCTCCTGCTGCCCGG - Intronic
1123402846 15:20004067-20004089 GCACCCAGCCTCCTGCTGACTGG - Intergenic
1123512183 15:21010721-21010743 GCACCCAGCCTCCTGCTGACTGG - Intergenic
1124252077 15:28113415-28113437 ACACACAGCCTCCTGCAGGCGGG + Intronic
1127699264 15:61481237-61481259 CCTCTCAGCCTCCAGCTGGCGGG - Intergenic
1127875387 15:63107258-63107280 AATCCCAGCAACTTGGTGGCTGG - Intergenic
1128791159 15:70434902-70434924 AATCCAAACCTCCTGCTAGGAGG + Intergenic
1128867431 15:71125243-71125265 ACTCCCAACAGCCTGCTGGCTGG + Intronic
1129165539 15:73775201-73775223 AGTGCCGCCCTCCTGCTGGCTGG - Intergenic
1130461357 15:84159949-84159971 AGTGCCAGCCTCATCCTGGCGGG - Intergenic
1131069866 15:89459538-89459560 CACCCCAGCCTCCTGCCAGCTGG + Intergenic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1131814458 15:96207793-96207815 AATCAGAGCTTCCAGCTGGCTGG + Intergenic
1132087391 15:98919394-98919416 AACCCGAACCTCCTGCTGGTTGG - Intronic
1132117031 15:99145154-99145176 GATACCAGCCTCATCCTGGCTGG + Intronic
1132145364 15:99426103-99426125 CACCGTAGCCTCCTGCTGGCTGG - Intergenic
1132251049 15:100335479-100335501 AGTCCCAGCCTCCTGGAGGTAGG - Intronic
1132338086 15:101061483-101061505 CAACCCTGCCTGCTGCTGGCTGG + Intronic
1133008240 16:2896466-2896488 ACTCTCACCCTCCTGCTCGCTGG - Exonic
1133038134 16:3046151-3046173 CTTCCCAGCCTCCTGCTGCCCGG + Intergenic
1134055997 16:11170269-11170291 CCACCCAGCCTTCTGCTGGCTGG - Intronic
1134672209 16:16064265-16064287 AACTCCAGTCTCCTGCTGCCTGG + Intronic
1135385441 16:22035376-22035398 AATCCCCTCCTGCTTCTGGCAGG - Intronic
1135465528 16:22681568-22681590 AATGCTCGCCTGCTGCTGGCTGG + Intergenic
1135981576 16:27151828-27151850 GATCACAGCTTCCTGCTGGCTGG - Intergenic
1136102100 16:28003883-28003905 AATCCCAGCCTCCATCTTTCTGG - Intronic
1138152483 16:54671417-54671439 TATCTCAGCCTCCTGAAGGCTGG - Intergenic
1138415194 16:56867616-56867638 AACCCCAGCCTCCTGCCTCCCGG - Intronic
1138565198 16:57828041-57828063 AATCCCAGCCTGCTCCTTACTGG - Intronic
1139378921 16:66518044-66518066 ATTCCCGACCTCCTGCTGCCTGG + Intronic
1140213835 16:72991889-72991911 AATCACAGGCTCGTGCTGGTTGG - Intronic
1141432212 16:83976117-83976139 AATCCCAGCCTCCCTCTGGCTGG - Intronic
1142031143 16:87839142-87839164 ACTCCCAGCCCGCTGCCGGCAGG - Intronic
1142417672 16:89951731-89951753 CATCCCTGCCTCCTGCTGCCTGG - Intronic
1142493371 17:292907-292929 AATGCCAGCCACCTGCTGCCGGG + Intronic
1143713623 17:8751949-8751971 AATCCCAGCCTCCCCTGGGCTGG - Intergenic
1144187907 17:12813826-12813848 ATTCCCAGGCTGCTGCAGGCTGG + Intronic
1144822980 17:18088390-18088412 AACCTCAGTCTCCTGATGGCTGG + Intronic
1144953137 17:19004592-19004614 AGCCCCAGCCTCCTCCGGGCAGG - Intronic
1145101785 17:20083217-20083239 AATGCCAGCCAGCTGCTGGTGGG + Intronic
1146595338 17:34163441-34163463 AATCCAAGCCTCCTGCTCCTGGG - Intronic
1147129468 17:38398362-38398384 AATCCCAGCCTCCCACTGGGAGG - Intronic
1147138353 17:38447829-38447851 AATGCCAGCCTGCTGTTGCCTGG + Intronic
1147327211 17:39675207-39675229 AAGCCCAGCTTCCTCCTGGCTGG + Intronic
1147343087 17:39766840-39766862 AGTCCCAGGCTCCTGTGGGCTGG - Intronic
1147937964 17:44024407-44024429 AATCTCAGCCATCTGCCGGCTGG - Intergenic
1148000238 17:44383564-44383586 GCCCCCAGCCTCCTGCTGACTGG - Exonic
1148432800 17:47656133-47656155 AATCCCAGCTACTTGCTGGGGGG + Intronic
1150489566 17:65564878-65564900 TGGCCCAGCCTCCTGCTGGGAGG - Intronic
1151826638 17:76527603-76527625 CACCCCACCCTCCTCCTGGCCGG - Exonic
1152307992 17:79532293-79532315 AGTCCCAGCCTGGAGCTGGCTGG - Intergenic
1154307565 18:13241683-13241705 TGTCCCAGCCTCCTGCTGCAGGG + Intronic
1155074050 18:22339859-22339881 AACCCCAGCCTGCTGCAGGGTGG - Intergenic
1156020435 18:32594154-32594176 AATACCATCCTCCAGCTGGCAGG + Intergenic
1156964854 18:43078689-43078711 AATCCCAGACTCCCGCTTCCCGG + Intronic
1157434542 18:47657468-47657490 ATTCTCAGACTCCTGCAGGCTGG - Intergenic
1158859898 18:61581977-61581999 AAACCCAGCCTCCCGGTGCCCGG + Intergenic
1163322563 19:16583166-16583188 AATTGCAGCCTCTTGCTGTCAGG + Intronic
1163790399 19:19302825-19302847 AATCCCAGCCAAGTGCTGGTGGG - Intronic
1164530267 19:29043135-29043157 TATCCTAGCCACCTGCTCGCTGG - Intergenic
1164686491 19:30169611-30169633 AACCCTGGCCTCCTGCAGGCTGG + Intergenic
1164752935 19:30669564-30669586 AATCCCACTCTCCTGCTGCGGGG + Intronic
1165116792 19:33533502-33533524 AATCCCACCCTCCTTCTGGATGG + Intergenic
1167382553 19:49147029-49147051 AATCCACGCCTCCCCCTGGCTGG - Intronic
1167711082 19:51111441-51111463 ACTCCCAGCCCTCTGCTGTCTGG + Intergenic
1168145247 19:54416598-54416620 AATCCCAGCCCCCTTCTCCCAGG - Intronic
925369803 2:3336360-3336382 ACCCCCAACCTCCCGCTGGCAGG + Intronic
925607047 2:5670010-5670032 AATCACAGCATCCTGTGGGCAGG - Intergenic
926385578 2:12332816-12332838 AATCCCAGCTTTCTGCTCACTGG + Intergenic
927089284 2:19698279-19698301 AATCCCAGCCACCTGTAGCCTGG - Intergenic
927506934 2:23620880-23620902 AACTCCAGCATCCTGCTGGCTGG + Intronic
927531908 2:23813629-23813651 TACCTCAGCCTCCTGGTGGCTGG - Intronic
927826900 2:26315596-26315618 AGTCCCATCCTCCTGCAGCCAGG - Exonic
927887709 2:26728726-26728748 GAGCCCGGCCTCCTGCCGGCTGG - Exonic
927974286 2:27326482-27326504 GATCACAGCCCCCTGCGGGCAGG - Exonic
928596508 2:32863998-32864020 ACGCCCAGCCTCCAGCTGCCGGG - Intergenic
928987934 2:37198530-37198552 AATCCCAGCTCGCTGCTGTCAGG - Intronic
932213667 2:69952389-69952411 CATCTCAGCCTCCTGGTAGCTGG - Intergenic
933063457 2:77767593-77767615 AAGCCGAGTCACCTGCTGGCAGG + Intergenic
933811936 2:86038069-86038091 AAGCCCATCCTCCTGCTCCCCGG + Intronic
934692711 2:96374039-96374061 AATCCCAGGATTCTGCTGGAGGG + Intergenic
937737638 2:125311978-125312000 ATACCCAGCCTCCTGGTGGTTGG - Intergenic
938100892 2:128497608-128497630 AAACCAAGGCTCCTTCTGGCTGG - Intergenic
940258893 2:151760301-151760323 AATAGCAGCCACCTGCGGGCTGG + Intergenic
941966927 2:171310073-171310095 AATCCCACCCTCCTCCTTCCTGG + Intergenic
945459496 2:210088871-210088893 AACCCCACCTTCCTGATGGCTGG - Intronic
946149182 2:217752821-217752843 AATCTCGGCCACCTGCTGGAGGG + Intronic
947394740 2:229675478-229675500 AAGTCCAGCTTCCTGCTGGATGG - Intronic
947585866 2:231356285-231356307 AAGGCCAGCCGCCTGCTGGAAGG + Intronic
1169067444 20:2701975-2701997 CTTCCCTGCCTCTTGCTGGCTGG + Intronic
1170024248 20:11871862-11871884 AGGACCATCCTCCTGCTGGCTGG - Intergenic
1170477948 20:16735062-16735084 AATCCCAGGCTCTTTCTGGCTGG - Intronic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1172947032 20:38697527-38697549 GATCCCCATCTCCTGCTGGCTGG - Intergenic
1173020101 20:39259996-39260018 GAACCCAGCCACCCGCTGGCAGG + Intergenic
1173175486 20:40761873-40761895 AATTCCAGCCTCCTGGGGGAGGG + Intergenic
1173703751 20:45095208-45095230 CATCCCAGCCTGCTGGTGGTGGG - Exonic
1174271753 20:49374449-49374471 CATCCCAGCCTCTTTCTGGTGGG - Exonic
1174726856 20:52871583-52871605 AATCCCAGCCTCATGATGGGAGG - Intergenic
1175237095 20:57522249-57522271 AATCCCAGGCACCTGATGCCAGG + Intronic
1175740253 20:61415006-61415028 AAGCCCAGCCTCCCTCCGGCTGG - Intronic
1175799272 20:61791940-61791962 ACACCCAACCTCCTACTGGCTGG - Intronic
1176033965 20:63027417-63027439 AATGCCAGCCCCCTGCAGCCTGG + Intergenic
1176050463 20:63116638-63116660 AAACCCAGCTTCTGGCTGGCCGG - Intergenic
1178504627 21:33152667-33152689 CCTCCCAGCCTTCTGCCGGCCGG + Intergenic
1179485992 21:41711086-41711108 ACCCCCAGCCTCCTGCTGCCCGG + Intergenic
1179526899 21:41984847-41984869 TATCCCAGTCTCCTGCAGTCTGG - Intergenic
1179886775 21:44317545-44317567 AAACCCAGCAGCCTGCAGGCTGG - Intronic
1180798388 22:18619313-18619335 ACCCCCAGCCTCCTGCAGTCTGG + Intergenic
1181035805 22:20169307-20169329 AAACACATCCTCCTGCTGGTGGG + Intergenic
1181223330 22:21375952-21375974 ACCCCCAGCCTCCTGCAGTCTGG - Intergenic
1181255410 22:21559674-21559696 ACCCCCAGCCTCCTGCAGTCTGG + Intronic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1183114321 22:35678160-35678182 GCTCCCAGCCTCCTGCAGGGAGG - Intergenic
1184570316 22:45319448-45319470 ACTCCCGGCCTCCTGCTGTGGGG - Intronic
1185002491 22:48254388-48254410 AACAGCAGCCTCCTGCTTGCTGG - Intergenic
953034109 3:39196834-39196856 AGTCCTGGCTTCCTGCTGGCTGG + Intergenic
953415310 3:42712262-42712284 CATCCCAGCCCCCTCCAGGCTGG - Intronic
953552647 3:43916017-43916039 AGCCTCAGCCTCCTGCTAGCTGG + Intergenic
953683734 3:45060029-45060051 AAGTCCAGCCTCCTGCTGCCCGG - Intergenic
953730530 3:45443629-45443651 ACTCCCAGCCTCCTCTGGGCAGG + Intronic
954272972 3:49523874-49523896 AATCCCAGCTCCAGGCTGGCTGG - Intronic
956834092 3:73081498-73081520 CACCCCAGCCTCCTGGTAGCTGG + Intergenic
957176968 3:76824123-76824145 ATTCCCTTCCTCCTTCTGGCTGG - Intronic
959858531 3:111190000-111190022 CATCCCTGCCTCCTGCTGTGTGG - Intronic
962437563 3:135380827-135380849 CATCCATGCCTCCTACTGGCTGG - Intergenic
963215983 3:142748686-142748708 TATCTCATACTCCTGCTGGCAGG + Intronic
963526555 3:146422422-146422444 AATTTCAGCCACCTGCAGGCTGG - Intronic
965367139 3:167814838-167814860 AATCCTGGCCTCATGCTGCCTGG + Intronic
966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG + Intronic
967296375 3:187969096-187969118 ACTCCCAGCCTCATACTGCCTGG - Intergenic
967824329 3:193866677-193866699 AATTCCAGCCTCTTGCTGAAAGG - Intergenic
970193648 4:13536554-13536576 ATTCCCAGGCCCCTGCAGGCAGG - Intergenic
970231267 4:13913573-13913595 ATTCTCAGCCTCCTGCTGCTTGG + Intergenic
970474999 4:16413032-16413054 AAGCCCATCCTCCTGCTGTGTGG + Intergenic
971333129 4:25698927-25698949 AATCCCAGCCACCGTCTGACTGG - Intergenic
978576740 4:110196844-110196866 ACTCCCAGCTTCCCGCGGGCTGG - Intronic
978763676 4:112382256-112382278 TTTCCCTGCCTCTTGCTGGCTGG - Intronic
985551166 5:534363-534385 AACCTCAACCTCCTGCAGGCGGG + Intergenic
985692151 5:1319467-1319489 CATGCCAGCCTCATGCTGGCTGG + Intronic
986758219 5:10857206-10857228 GACCCCCGCCCCCTGCTGGCAGG - Intergenic
989957054 5:50370912-50370934 AATACCAGGCACCTGTTGGCTGG + Intergenic
990540049 5:56763525-56763547 AAACCCAGCAGACTGCTGGCTGG - Intergenic
990667428 5:58089152-58089174 TTTCCCAGCCTCCTGCTTCCTGG - Intergenic
993391518 5:87324246-87324268 AATACTAGCCTCCTGCTAGTAGG + Intronic
996021525 5:118595876-118595898 AGACCCAGGCTCCTCCTGGCAGG + Intergenic
996629099 5:125606406-125606428 AAGCCAAGCCTCCAGCTGGATGG - Intergenic
997675296 5:135708103-135708125 TATCCCAGGCCCCTGCTGCCTGG - Intergenic
999152663 5:149436644-149436666 AATCCCGCCCTCCTTCTGCCAGG - Intergenic
999261277 5:150240386-150240408 ATTCACAACCTCCTGGTGGCTGG + Intronic
999906779 5:156149739-156149761 CATGCCAGCCTCCTTCAGGCAGG - Intronic
1002209497 5:177588674-177588696 ACTCCCCGCCTCCTACTCGCTGG + Intergenic
1002301840 5:178261847-178261869 CAGCCCAGCCTCCTGCTCTCTGG - Intronic
1002465823 5:179407939-179407961 AACTCCAGGCTCCTGCTGGCTGG - Intergenic
1003528172 6:6915705-6915727 AATCCCAGCCTCCAGAAGGCAGG + Intergenic
1004185120 6:13415071-13415093 AAGCCCAACTCCCTGCTGGCAGG + Intronic
1004518287 6:16339217-16339239 AAACCCAGCCCCCTGGTGGCTGG - Intronic
1005980456 6:30832351-30832373 AATCCCACCTTCCTGGAGGCTGG + Intergenic
1006185651 6:32180248-32180270 TCACCCAGCCTCCAGCTGGCAGG + Exonic
1006195084 6:32235237-32235259 AGTCCCAGCTTCCTACTTGCTGG + Intergenic
1006925992 6:37655406-37655428 CATCCCAGTCTGCTGCTGGGTGG - Intronic
1007777136 6:44230132-44230154 AAGCCCAGCCTCCGCCTGGAGGG + Intronic
1007906136 6:45462937-45462959 AACCCCAGAGTTCTGCTGGCTGG + Intronic
1015715045 6:136183756-136183778 CATTCCAGCCTGCTCCTGGCAGG + Intronic
1017788960 6:157778916-157778938 AATGACAGCCTCCTGCCGGGAGG + Intronic
1018170057 6:161137495-161137517 GATGCGTGCCTCCTGCTGGCTGG - Intronic
1018968160 6:168504781-168504803 AATCCCATCCTCCTGGAGGCTGG + Intronic
1019104780 6:169659488-169659510 AGCCTCAGCATCCTGCTGGCCGG - Exonic
1020118326 7:5488662-5488684 AGTCGCAGCCTCCCACTGGCTGG + Intronic
1020439784 7:8205207-8205229 AATCCCTGCCTTTTCCTGGCAGG + Intronic
1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG + Intronic
1022504699 7:30902882-30902904 AAGCTCTGCCTCCTGCTGGAAGG + Intergenic
1023905978 7:44521802-44521824 CATCCCTGCCTCCTCCTGGGTGG - Exonic
1023947079 7:44811741-44811763 TATCTCAGCCTCCTGGTAGCTGG + Intronic
1029129205 7:98317518-98317540 CACACCATCCTCCTGCTGGCCGG + Intronic
1030130222 7:106193603-106193625 ACTCCCATCCTCCTGCTTCCTGG - Intergenic
1030248175 7:107409004-107409026 AATACAAGCATCCTGCAGGCAGG + Intronic
1030683641 7:112459844-112459866 ATTCCCAGCCTCCAGGTGGCTGG - Intronic
1030842960 7:114378742-114378764 AATCACAGCCTTCTGCTGTCTGG + Intronic
1032541252 7:132704913-132704935 AACCCCATCCTCCTTATGGCTGG - Intronic
1034007722 7:147492312-147492334 AATGCCTGCCTCCTGCTGTGAGG + Intronic
1035641814 8:1189842-1189864 AATCTCCGCCTCCTGCCTGCTGG - Intergenic
1035654213 8:1293300-1293322 GAGCCCAGCCTGCTGCTGCCTGG - Intergenic
1035654240 8:1293399-1293421 GAGCCCAGCCTGCTGCTGCCAGG - Intergenic
1036436947 8:8743465-8743487 AGCCCCAGCCTCCTGCTGCAGGG + Intergenic
1036964033 8:13276490-13276512 AATGCCGGCCTCCTGAAGGCAGG - Intronic
1036965047 8:13288420-13288442 AACTCTAGCCTCCAGCTGGCTGG + Intronic
1037762522 8:21751333-21751355 AATGCCAGTGTCCTGCTGGTGGG - Intronic
1038002144 8:23401076-23401098 TAACCCAGCCTCCTCATGGCTGG - Intronic
1038853766 8:31308174-31308196 AATTCCAGCCTCATGCTCCCAGG - Intergenic
1038994276 8:32904094-32904116 AAGCCCAGCTGCCTGCTGCCAGG + Intergenic
1047779501 8:128099961-128099983 AAACCCACCCTGCGGCTGGCTGG - Intergenic
1047984392 8:130217576-130217598 AATCCCTGCCTCTTGCGGTCTGG - Intronic
1048007047 8:130427885-130427907 AATCTCATCTTCCTGGTGGCAGG + Intronic
1048638939 8:136331200-136331222 CACCTCAGCCTCCTGCTGGCTGG - Intergenic
1048833585 8:138497950-138497972 ATTCCCTGCCTCCTCCTGGGTGG - Intergenic
1049614972 8:143572105-143572127 AAAGCCAGCCTCCTCCAGGCAGG + Exonic
1051660166 9:19418888-19418910 AATAAAAGCCTACTGCTGGCCGG + Intronic
1055030748 9:71769461-71769483 AACCCCAGCATCCCGCTCGCAGG + Intronic
1055085060 9:72305344-72305366 AATCCCATCCTCCTGGAGCCAGG - Intergenic
1055563220 9:77542819-77542841 GATCCCAGGCCCCTGATGGCAGG + Intronic
1056890666 9:90488834-90488856 CATCCCTGCCTCCAGCTCGCTGG - Intergenic
1057746991 9:97760303-97760325 AATTCCAGATTCCTGCTGCCTGG + Intergenic
1058766564 9:108187960-108187982 GGGCCCAGCCTCCTGCTGCCAGG + Intergenic
1059453764 9:114387176-114387198 ACCCCCACCCACCTGCTGGCAGG + Intronic
1059764838 9:117374244-117374266 AGTCTCTGCCTCATGCTGGCAGG + Intronic
1059955387 9:119510471-119510493 AATCCTAGCCACCTTCTGGGAGG + Intronic
1061755501 9:132809450-132809472 TCTCCCATCCTCCCGCTGGCAGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062399745 9:136367181-136367203 AAGGCCAGCCTCGTGCTGGCTGG + Intronic
1185587332 X:1249577-1249599 GCTCCCAGCCTCCTCCTAGCTGG - Intergenic
1187185288 X:16978660-16978682 AATCCCAGCCTCCATTTTGCAGG + Intronic
1189465581 X:41275837-41275859 CCTCCCTCCCTCCTGCTGGCTGG + Intergenic
1190164945 X:48065532-48065554 AATCCCAGCTACTTGGTGGCGGG + Intronic
1192013017 X:67295647-67295669 AAACCTAGCCTCCTGCTGATAGG + Intergenic
1192179439 X:68907186-68907208 AATCCCAGCCTCCAGGGGCCTGG - Intergenic
1194002447 X:88448186-88448208 AATGTCAGCCTCCTGAAGGCAGG - Intergenic
1195046597 X:101060059-101060081 CACCTCAGCCTCCTGCTAGCTGG - Intergenic
1199198063 X:145055988-145056010 ATTCCCAGTCTCCATCTGGCAGG + Intergenic
1202377898 Y:24255185-24255207 AGTGCCAGCCTCATCCTGGCAGG + Intergenic
1202492884 Y:25414936-25414958 AGTGCCAGCCTCATCCTGGCAGG - Intergenic