ID: 966383423

View in Genome Browser
Species Human (GRCh38)
Location 3:179367459-179367481
Sequence AAGATGCCTGCATTTCTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966383420_966383423 12 Left 966383420 3:179367424-179367446 CCGTTTTCTCTGTAGGTACGCAG 0: 1
1: 0
2: 1
3: 5
4: 120
Right 966383423 3:179367459-179367481 AAGATGCCTGCATTTCTTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966383423 Original CRISPR AAGATGCCTGCATTTCTTGG TGG Exonic
902847850 1:19126317-19126339 AAGGAGCCGGCATTCCTTGGTGG - Intronic
904450807 1:30610070-30610092 AAGATGCCTGCATTCATCAGAGG + Intergenic
904590106 1:31608917-31608939 CAGATGTCTGCATTTGTTAGGGG - Intergenic
905923304 1:41733145-41733167 AAGATGCCAGCAGTCCCTGGGGG - Intronic
909043906 1:70686416-70686438 AAGGGGCCTGCCTTTCCTGGTGG - Intergenic
911896302 1:103439209-103439231 AAGCTGCCTGCTTTTCATTGTGG - Intergenic
912533810 1:110347698-110347720 AACAAGCCTGCATTTCAAGGTGG - Intergenic
915913346 1:159927728-159927750 GAGATGCCTGCCTTTCCGGGGGG + Intronic
915943348 1:160132976-160132998 ATGATTCCTGCCTTTCTAGGTGG - Intronic
916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG + Exonic
916819100 1:168380836-168380858 AAGAAGCTTCCATTTCTTGAGGG + Intergenic
919834801 1:201566243-201566265 GAGCTGCCGGCATTTCATGGGGG - Intergenic
922374578 1:224948803-224948825 AAGATACTTGCATTTTCTGGGGG - Intronic
923080770 1:230652353-230652375 AAGATTCCTCCATGTCTTTGTGG + Intronic
923308902 1:232715812-232715834 AAAATTCCTGCCTTTCATGGAGG + Intergenic
924181378 1:241441942-241441964 AAGAAGCCTACATTTCCAGGAGG + Intergenic
924640828 1:245831982-245832004 AAGCTCACTGCCTTTCTTGGAGG + Intronic
924941506 1:248815489-248815511 ATGATGCTTTCATGTCTTGGGGG + Intronic
1062955044 10:1534590-1534612 ATGATCCCTGCATTAGTTGGCGG + Intronic
1064286945 10:13999790-13999812 AAGATGCTAGCTCTTCTTGGTGG - Intronic
1065862156 10:29881046-29881068 AAGAAGCCTACATCTCTTAGTGG + Intergenic
1067140450 10:43652035-43652057 AAGAGGCCTGCATTTCTGACAGG - Intergenic
1068338610 10:55670860-55670882 AAGTTGCCTTCATGTCTTGCTGG - Intergenic
1071355444 10:84789209-84789231 AAACTGCCTGCAGCTCTTGGAGG + Intergenic
1073467472 10:103702633-103702655 AAGAAGGCTGTATGTCTTGGGGG + Intronic
1074900807 10:117815175-117815197 AAGATGCCTGCATCTTTCAGGGG - Intergenic
1075930994 10:126295735-126295757 AATATGCCTGGACTTTTTGGTGG + Intronic
1076200350 10:128552837-128552859 AAGAAGCCTGCATTTGCTGAAGG + Intergenic
1076576307 10:131472032-131472054 AAGATTCTTGAAGTTCTTGGTGG + Intergenic
1077913438 11:6594538-6594560 AATATGCATGCATTTCCTGTGGG + Intergenic
1080638104 11:34140908-34140930 AGGAAGACAGCATTTCTTGGTGG + Intronic
1081015955 11:37880877-37880899 AACATACCTGCATTTTCTGGTGG - Intergenic
1081016070 11:37882682-37882704 AACACGCCTGCATTTTCTGGCGG + Intergenic
1083803536 11:65060084-65060106 AAGATGCCTGCAGAGCTTGGGGG + Intergenic
1085828400 11:79872978-79873000 AAGAAGACTGCACTTCTTGAGGG - Intergenic
1089890558 11:121876279-121876301 AATGTGCCTGTATTCCTTGGGGG + Intergenic
1090868837 11:130725303-130725325 AGGGTGCCTGCATTTCTTGGTGG - Intergenic
1092124143 12:6064059-6064081 AGGAAGCCTTCCTTTCTTGGAGG + Intronic
1092471486 12:8785837-8785859 AGGAAGCTTGCATTTCATGGCGG + Intergenic
1092744917 12:11664401-11664423 GAGATGGCAGCTTTTCTTGGTGG + Intronic
1093316793 12:17662307-17662329 AACATGCCTGCTTTTCTAGATGG + Intergenic
1095311197 12:40699022-40699044 CAGGTGCCACCATTTCTTGGAGG + Intronic
1096031432 12:48419179-48419201 AAAAAGCCTGCATTTCTTTAGGG - Intergenic
1099015774 12:77342432-77342454 AAGATGCAAGCATGTTTTGGAGG - Intergenic
1101272603 12:103163391-103163413 AAAATGCCTCCATTTCATGTTGG + Intronic
1108386664 13:49905277-49905299 AAGATGCCAGCATTTGCTGAGGG - Intergenic
1108465654 13:50712956-50712978 AAGATGACAGGATTACTTGGAGG + Exonic
1108778638 13:53799272-53799294 AAGATGCAAGCAGTTCCTGGTGG + Intergenic
1111236216 13:85412036-85412058 AAGATGACTCCATTTCTCAGTGG - Intergenic
1111250281 13:85592484-85592506 AGTTTGCCTGAATTTCTTGGAGG - Intergenic
1111627199 13:90804369-90804391 AAGATGACTGGATTTATTGATGG - Intergenic
1112252357 13:97793746-97793768 AAGAGAACTGCATTTCTTGGGGG - Intergenic
1112686462 13:101833559-101833581 AAGATGCCTACATTTTTTAAAGG + Intronic
1113461980 13:110488480-110488502 AAGATGCCTGAGTTGCTCGGTGG - Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1117656507 14:57961615-57961637 AAGATGCCTATAATTCCTGGCGG + Intronic
1119108129 14:71943629-71943651 AAGATGCCTCTGTTTCCTGGAGG + Intronic
1126053684 15:44710385-44710407 AAGGTGCCGCCATTTCGTGGTGG - Intronic
1126164860 15:45646193-45646215 AAGAGTCCTGCATCTCTGGGTGG - Intronic
1126256609 15:46634675-46634697 AAAATGCCTGCATTTGGTGGTGG + Intergenic
1126672250 15:51126992-51127014 AAGTTGCCTGCACTGCTTGTGGG + Intergenic
1127548131 15:60009074-60009096 AAGATGCCTGCATTTGTGAAAGG - Intronic
1127867655 15:63044637-63044659 TAGATGGCTGCACTTCATGGTGG + Intronic
1130048225 15:80462264-80462286 AAGATGCCTCCATGTACTGGTGG - Intronic
1131110399 15:89761185-89761207 CAGATGCGTGCTTTTCCTGGTGG - Intronic
1133114676 16:3570560-3570582 AAGAAGCCTGGAATTCTAGGGGG + Intronic
1134081749 16:11329468-11329490 AAAGGGCCTGAATTTCTTGGGGG + Intronic
1135758271 16:25115980-25116002 AGGATGATTACATTTCTTGGGGG - Intronic
1138730456 16:59188415-59188437 ATGATGCCTGAGGTTCTTGGTGG + Intergenic
1138891213 16:61146216-61146238 AAGCTGCCTGAACTTTTTGGGGG + Intergenic
1140187217 16:72786006-72786028 TAGCTGCCTTCATTTCTTAGAGG - Exonic
1140594007 16:76387046-76387068 AGGATGCATGCTTTTTTTGGAGG - Intronic
1142712113 17:1729154-1729176 AACATGGCTGCATTCCTAGGAGG + Intronic
1145125543 17:20297107-20297129 AGGACTCCTGCATTTCTTAGAGG - Intronic
1146812778 17:35917116-35917138 AAGATGACTGGATCTCTTGGAGG + Intergenic
1149094983 17:52828870-52828892 AGGCTGGCTGCATTTCTCGGAGG + Intergenic
1150581791 17:66481022-66481044 CAGATGGCTGCCTGTCTTGGTGG + Intronic
1150826876 17:68484113-68484135 AAAATGCCTGCAGTTGTTTGTGG - Intergenic
1150858643 17:68777719-68777741 AAGATTCTTGCAGTCCTTGGGGG + Intergenic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1153389333 18:4536091-4536113 AAGCTGCCTGCATTTCCTAGAGG + Intergenic
1155553011 18:26986723-26986745 AAGATGACAGGATTTCTTGTTGG + Intronic
1156563977 18:38163053-38163075 GAGATCACTGCATTTCTTCGAGG + Intergenic
1156829759 18:41477740-41477762 AAGATGGCTGCTTCTCTTAGAGG + Intergenic
1157304780 18:46509010-46509032 CAGCTGCCTTCCTTTCTTGGTGG + Intronic
1158654442 18:59317532-59317554 AAAATGCCTTTATTTTTTGGAGG + Intronic
1160952306 19:1673653-1673675 AAGAGCTCTGCATCTCTTGGGGG - Intergenic
1161600435 19:5179186-5179208 AAGATGCCTGAAATCCTTTGAGG - Intronic
1164016033 19:21256725-21256747 AAGATGCCTTCTTTTGTTTGAGG + Intronic
925271638 2:2613820-2613842 AAGATGCCTGCTTCTCTGGAGGG + Intergenic
926918358 2:17915110-17915132 AGGCTGGCTGCATTTCCTGGTGG - Intronic
927042639 2:19245274-19245296 AAGTAGCCTTCATCTCTTGGTGG - Intergenic
927305344 2:21565083-21565105 ATGATGACTGCGTTTTTTGGAGG + Intergenic
930849885 2:55949040-55949062 AACAAGCCTGCCTTTATTGGTGG - Intergenic
932193747 2:69764590-69764612 AAGATGGGTGCATTTTATGGTGG - Intronic
933096272 2:78186536-78186558 AAGATGACTACATTGCTTAGTGG - Intergenic
933200093 2:79438166-79438188 AAGAAGCCTGGATTTCTTGTGGG + Intronic
939140961 2:138354133-138354155 AAGATGCATGAAGTCCTTGGTGG + Intergenic
940881721 2:158953467-158953489 AAGGTGGCTGCCTTTCTTGCAGG + Intergenic
942363359 2:175196351-175196373 AGGCTGCCCGCATTCCTTGGTGG - Intergenic
944391529 2:199224654-199224676 CAGATGCCTGCATGACTGGGAGG - Intergenic
945830558 2:214779584-214779606 AAGATTCCTGTATTTCTGTGTGG - Intronic
946731620 2:222715272-222715294 CAGCTCACTGCATTTCTTGGAGG - Intergenic
946814302 2:223560598-223560620 AAGGTAGCTGCATTTCTTTGAGG - Intergenic
946943147 2:224791337-224791359 AAGATTCCTGAATTTTTGGGTGG + Intronic
1169545125 20:6642146-6642168 GAGATGGCGGCATTTCTTTGGGG - Intergenic
1171517273 20:25747493-25747515 GAAGTGGCTGCATTTCTTGGAGG - Intergenic
1176985726 21:15433356-15433378 AAGATGCTTACCTTTCTTCGAGG - Intergenic
1179008486 21:37534713-37534735 ATGATGCCTGCATTTGTTTGAGG + Intergenic
1179350913 21:40610208-40610230 AAAATGCCCACATTTCTGGGAGG + Intronic
1183165041 22:36141133-36141155 AAAATGCCTGCATTTTGTCGTGG + Exonic
1183263288 22:36810247-36810269 AAGATGCCTTCAACTCCTGGCGG - Intronic
1185281171 22:49970529-49970551 GAGTTGCCTGCATTCCTGGGTGG - Intergenic
949410661 3:3760659-3760681 ACGATGCCTTAATTTCCTGGGGG - Intronic
950750152 3:15122057-15122079 AGGCTGCCTGCATTCCTTGGTGG - Intergenic
951621800 3:24609936-24609958 AAGATGCCAACATTTCTTCTAGG + Intergenic
951942969 3:28102089-28102111 AACATGCCTGCCCTTATTGGAGG + Intergenic
952614780 3:35257577-35257599 AAGATGTGTGAAGTTCTTGGAGG - Intergenic
953844735 3:46418451-46418473 CAGATGCCTGCATAACTGGGAGG - Intergenic
953901575 3:46846686-46846708 AAGATGCCTGGGCTCCTTGGGGG - Intergenic
953906915 3:46872994-46873016 GAGAAGCCTCCATCTCTTGGGGG - Intronic
954049568 3:47962414-47962436 AAGCTGATTGCATATCTTGGAGG - Intronic
954517115 3:51188179-51188201 GAGATGCCCTCATATCTTGGAGG + Intronic
954794025 3:53152344-53152366 AAGATGCCTGGCTTCCTTGCCGG - Intergenic
955896637 3:63707482-63707504 AAGATGCCTATTTTTCTCGGAGG - Intergenic
956512927 3:70014302-70014324 TAGACGCCTCCATGTCTTGGGGG - Intergenic
956531701 3:70227005-70227027 AAGATGCATGTATTTTTTCGAGG - Intergenic
961115291 3:124323913-124323935 CAGCTGCCTGCATTTATCGGCGG + Intronic
961165268 3:124759405-124759427 AAGATGCCTCGAATTCTTGGTGG - Intergenic
962585931 3:136842839-136842861 ATGGTGCCTGGATTTGTTGGAGG + Intronic
964155319 3:153577939-153577961 AAGATGCTTGTATTTCTGTGTGG - Intergenic
964646073 3:158959725-158959747 GAGATGCCTGCATGTGCTGGAGG + Intergenic
966304830 3:178519759-178519781 TAGATGCCTGCTTTTGTTGATGG - Intronic
966383423 3:179367459-179367481 AAGATGCCTGCATTTCTTGGTGG + Exonic
966703749 3:182887251-182887273 AAGATGCCTGGAATACATGGAGG + Intronic
970474582 4:16409450-16409472 AAGAGGATTGTATTTCTTGGTGG + Intergenic
975779274 4:77821191-77821213 AAAATGCCTTCATCTCTTGGGGG + Intergenic
977176158 4:93822249-93822271 AAGATGTTTACATTTCTTGGGGG + Intergenic
978039736 4:104045110-104045132 CAGCTGCCTGCATCACTTGGTGG + Intergenic
979725276 4:123953709-123953731 AAGATGCTTGGATTTTTTGCTGG + Intergenic
982045031 4:151436069-151436091 AAGATAGCTGCATTTCTTTTTGG - Intronic
982977675 4:162087049-162087071 AAGAAGCTTGCATTTCTTTATGG - Intronic
983373702 4:166897671-166897693 AAGATGCTGCAATTTCTTGGAGG - Intronic
984395902 4:179199791-179199813 AAGATGCTAGCATTTCTATGTGG - Intergenic
985200528 4:187480301-187480323 AAACTGCATGCATTTCTAGGTGG + Intergenic
988022157 5:25634527-25634549 AAGATGCCTACATCTTTTGAGGG + Intergenic
989627560 5:43445083-43445105 AAGGTACCTGCTTTTCTTTGTGG - Exonic
991480102 5:67068681-67068703 AAAATGCCTGTATTTCTTTTTGG - Intronic
993218395 5:85056930-85056952 TACATGCCTGAATTTCATGGTGG - Intergenic
993452172 5:88085723-88085745 GAGATGGCTTCATTTTTTGGAGG - Intergenic
994515227 5:100763030-100763052 AAATTGCCTGCATGTCTTGATGG - Intergenic
998811170 5:145967453-145967475 ATTATGCCTCCATTTCATGGAGG + Intronic
999468807 5:151832627-151832649 CAGAGTCCTGTATTTCTTGGAGG - Intronic
1004265991 6:14148844-14148866 AAGACCCCTGCATATCCTGGTGG + Intergenic
1005436650 6:25819178-25819200 CAGATGCCTGCATTAATTAGGGG - Intronic
1006923937 6:37643973-37643995 AAGAGGCCTGGCTGTCTTGGGGG - Intronic
1007655430 6:43448624-43448646 AAGGTGCCTACATTTCACGGAGG - Intronic
1008096592 6:47345464-47345486 AAGATGACTGCATTCCCAGGAGG - Intergenic
1009521897 6:64693684-64693706 AAAATGCCTTCATGTCTTGAGGG + Intronic
1010276576 6:73974495-73974517 AAGATGCTTTCATTTCTTTGGGG + Intergenic
1012177496 6:96106493-96106515 AAGAGGCATGTACTTCTTGGTGG + Intronic
1014424931 6:121292369-121292391 AAGATGATTGCTTTTCTTTGGGG - Intronic
1018319913 6:162596981-162597003 AGGAGCCCTGCATTTCTTGAAGG - Intronic
1019311295 7:362162-362184 GAGATGCCTGAATTCCTTTGGGG + Intergenic
1020768869 7:12361728-12361750 ATGAATCATGCATTTCTTGGCGG + Intronic
1021266081 7:18524300-18524322 AAAATCCCTGCAATTCTTGTTGG - Intronic
1021840154 7:24715867-24715889 AAGAAGCCTGCATTTTAGGGCGG - Intronic
1023626221 7:42117646-42117668 TAGATGCCTGCTTTTGCTGGGGG + Intronic
1024163841 7:46709823-46709845 AGGCAGCCTGCATTTGTTGGAGG + Intronic
1024563330 7:50662360-50662382 AATAACCCTTCATTTCTTGGAGG - Intronic
1027486347 7:78766305-78766327 AAGATGCCTGAACTGCTTGCAGG + Intronic
1028148588 7:87345847-87345869 AAGGTGCCTGGATTTGGTGGGGG + Intronic
1028986118 7:97009774-97009796 ATGATTGCTGCATTTCTTGCAGG + Exonic
1029314181 7:99696495-99696517 AAGGTGCTTGCATTTCTACGAGG - Intronic
1033673376 7:143513791-143513813 GAGATGCCTGGCTTTCTTGGAGG + Intergenic
1036543883 8:9747265-9747287 AAGATGACTACATTTTTTTGAGG - Intronic
1036945455 8:13090568-13090590 AAGATGCCTGCACTGCTTTAAGG - Intronic
1037124358 8:15327483-15327505 AAGATTACAGCATTTTTTGGAGG - Intergenic
1038735500 8:30165496-30165518 AAGATGCCTAAATTGTTTGGAGG - Intronic
1038964346 8:32555159-32555181 AAGATGCTTGATTCTCTTGGGGG - Intronic
1040666116 8:49635513-49635535 AAGGATCCTGCATATCTTGGGGG + Intergenic
1040764423 8:50889875-50889897 AAGATGCCAACATTTTTGGGGGG + Intergenic
1042729725 8:71919153-71919175 CACATGCATGCATTTCTTTGAGG + Intronic
1048437594 8:134432539-134432561 AGGATTCTTGCATTTCTGGGTGG - Intergenic
1048963252 8:139597133-139597155 AACAGGCCTGCTTTTCTTGATGG + Intergenic
1049162727 8:141107896-141107918 AAGATGCCTGCAGCTCTTTTGGG + Intergenic
1050478142 9:6062313-6062335 CATAGTCCTGCATTTCTTGGAGG + Intergenic
1051368227 9:16336255-16336277 AAGATGCCAACAGATCTTGGAGG + Intergenic
1055031944 9:71779207-71779229 CAAATGGCTGCATTTATTGGTGG - Intronic
1056618484 9:88189378-88189400 AAGATGCTTGCATTTCTTTGTGG - Intergenic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1059857471 9:118415870-118415892 AAGATAGCTGCATTTCTTTTAGG + Intergenic
1060415646 9:123427911-123427933 AAGATGCCTGCAATCCTTCCAGG - Intronic
1187236159 X:17469495-17469517 AAGATGCCTGAACTCCTTAGAGG - Intronic
1189366491 X:40393071-40393093 AGGATGCCAGCTTTTCTTGCAGG + Intergenic
1190741024 X:53288921-53288943 AAGGTGCCTGGACTTCTTGTGGG - Intronic
1192686163 X:73307246-73307268 AAGAGTCCCACATTTCTTGGAGG - Intergenic
1192963732 X:76155732-76155754 AAGAAGGCTGCATTTCTAAGGGG - Intergenic
1194739446 X:97555370-97555392 AAGAAGACTGCATTTCTTAAAGG - Intronic
1195611796 X:106875308-106875330 AAGAGGTCTCCCTTTCTTGGAGG + Exonic
1195671528 X:107474130-107474152 AGGATACCTGCATCTCTGGGAGG - Intergenic
1198839556 X:140841738-140841760 CTGATGCCTGCTTTTTTTGGGGG + Intergenic
1199250205 X:145653002-145653024 AAAATGCATGCTTTTCATGGAGG - Intergenic
1200730407 Y:6731102-6731124 CAGAAGCCTGCATTTCCAGGAGG + Intergenic
1201419704 Y:13784967-13784989 AAGTGGCCAGCATTTATTGGGGG + Intergenic