ID: 966387107

View in Genome Browser
Species Human (GRCh38)
Location 3:179410594-179410616
Sequence GCTATTGTCCTTATAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 1, 1: 1, 2: 5, 3: 105, 4: 703}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966387107 Original CRISPR GCTATTGTCCTTATAAAAGG GGG (reversed) Intronic
900818754 1:4870300-4870322 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
900909067 1:5581517-5581539 ACTGTGGTCCTTATAAAAAGAGG + Intergenic
900933575 1:5751628-5751650 GACTGTGTCCTTATAAAAGGGGG + Intergenic
901197583 1:7448728-7448750 ATTAGTGTCCTTATAAAAAGAGG - Intronic
901528229 1:9837340-9837362 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
902041942 1:13499028-13499050 ACTGGTGTCCTTATAAAAAGGGG - Intronic
902759064 1:18569063-18569085 ACATGTGTCCTTATAAAAGGGGG - Intergenic
903697266 1:25217158-25217180 ACTGATGTCCTTATAAGAGGAGG + Intergenic
903976927 1:27156223-27156245 ACTGGTGTCCTTATAAAAAGGGG - Intronic
904294942 1:29514076-29514098 ACTAGTGTCCTTGTAAAAAGGGG - Intergenic
904892065 1:33787037-33787059 GCTGGTGTCCTTATAAGAAGAGG + Intronic
904916232 1:33972521-33972543 ACAAGTGTCCTTATAAGAGGGGG + Intronic
905858769 1:41332292-41332314 ACTGGTGTCTTTATAAAAGGAGG - Intergenic
905953956 1:41976741-41976763 ACTGATGTCCTTATAAAAAGGGG + Intronic
906699736 1:47849248-47849270 ACTGTTGCCCTTATAAAAAGAGG + Intronic
907180485 1:52565440-52565462 ATTAGTGTCGTTATAAAAGGAGG + Intergenic
907601371 1:55774558-55774580 ATTAGTGTCCTTATAAGAGGAGG + Intergenic
907703516 1:56813139-56813161 ACTGATGTCCTTATAAAATGGGG - Intronic
907881884 1:58557095-58557117 ACTACTGTCCTTATAAGAGGAGG - Intergenic
907900429 1:58736109-58736131 ACTGATGTCCTTATAAAAAGAGG + Intergenic
908039097 1:60088137-60088159 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
908113278 1:60917837-60917859 ACTGGTGTCCTTATAAAAAGGGG - Intronic
908415019 1:63904697-63904719 ACTGTTGTCCTTATAAGACGAGG + Intronic
908419794 1:63948733-63948755 ATTAGTGTCCTTATAAAAGAAGG + Intronic
908506192 1:64802674-64802696 AGTATTGTGCTTATTAAAGGTGG + Intronic
908846338 1:68328408-68328430 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
908891132 1:68849216-68849238 ACTAATGTCCTTATGCAAGGAGG - Intergenic
909062576 1:70896306-70896328 ACTGGTGTCCTTATCAAAGGGGG + Intronic
909348185 1:74616756-74616778 GCTGATGTCCTTATAAAAAGAGG + Intronic
911149393 1:94582780-94582802 ACTATTGTCCTTATAAGAAGAGG - Intergenic
912283365 1:108341273-108341295 GAGAGGGTCCTTATAAAAGGGGG - Intergenic
912540918 1:110414654-110414676 GCTGGTGTCCTCATAAAAAGGGG + Intergenic
913279620 1:117173325-117173347 GCTGGTGTCCTTATAAAAAGGGG + Intronic
913956805 1:143307468-143307490 GATTTACTCCTTATAAAAGGAGG - Intergenic
913980638 1:143508183-143508205 GATTTACTCCTTATAAAAGGAGG + Intergenic
914074999 1:144334611-144334633 GATTTACTCCTTATAAAAGGAGG + Intergenic
914104179 1:144631882-144631904 GATTTACTCCTTATAAAAGGAGG - Intergenic
914262964 1:146014916-146014938 GCTGTGGTCCTTAAAAGAGGTGG - Intergenic
915661405 1:157408683-157408705 ACTGATGTCCTTATAAAAAGAGG - Intergenic
916813158 1:168323949-168323971 ACTAGTGTCTTTATAAAAAGAGG - Intergenic
916874797 1:168957962-168957984 GCCATTGACCTAATAGAAGGTGG + Intergenic
916885100 1:169059817-169059839 ACTATTGTCCTTATAAGAAGAGG + Intergenic
917143141 1:171857880-171857902 ATTAGTGTCCTTATAAAAAGAGG + Intronic
917294827 1:173507668-173507690 ACTAGTGTCCTTATAAAAAGGGG + Intronic
918039287 1:180902601-180902623 ACTGGTGTCCTTATAAAATGAGG + Intergenic
918062788 1:181076607-181076629 GCTATTGTCCCTTCAGAAGGAGG - Intergenic
918531525 1:185527546-185527568 GCCAGTATCCTTATAAAAAGAGG + Intergenic
919989140 1:202697021-202697043 GCTGTTGTCCTCAGAAATGGGGG - Intronic
920520969 1:206625927-206625949 ACTATTGTCCTTATAAAAGGAGG + Intergenic
920702111 1:208225684-208225706 TCTGGTGTCCTTATAAAAAGGGG + Intronic
920843042 1:209570914-209570936 ACTGATGTCCTTATAAAAAGGGG - Intergenic
920872785 1:209807848-209807870 AATGGTGTCCTTATAAAAGGAGG + Intergenic
920957483 1:210632808-210632830 TCTGGTGTCCTTATAAAAAGGGG + Intronic
921685466 1:218084111-218084133 ACTAGTCTCCTTATAAAAAGAGG - Intergenic
921922642 1:220686440-220686462 ACTAATGTCCTTATAAAAAGAGG - Intergenic
922084255 1:222330675-222330697 GGTATTGTCATTAAAAAATGTGG - Intergenic
922141336 1:222890904-222890926 ACTGATGTCCTTATAAAAAGAGG - Intronic
922175781 1:223196013-223196035 ACTGATGTCCTTATAAAAAGGGG - Intergenic
923330619 1:232920607-232920629 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
923338919 1:232991620-232991642 ACCAGTGTCCTTATAAAAAGGGG + Intronic
923449880 1:234106573-234106595 ACTAGTGTTCTTATAAAAAGAGG - Intronic
923718734 1:236449182-236449204 GCCAGTGTCCTTATAAAATCGGG - Intronic
924144828 1:241063183-241063205 ACTACTGTCATTATAAAAGTTGG - Intronic
924319312 1:242831511-242831533 ACTAGTGTCCTTATAAGAAGTGG + Intergenic
924326385 1:242898546-242898568 ACTAGTGTCCTTATAAAAAGGGG - Intergenic
1062961795 10:1577872-1577894 CCTGGTGTCCTTATAAAAAGAGG + Intronic
1063031733 10:2242518-2242540 GTTAGTGTCCTTACAACAGGAGG + Intergenic
1063365752 10:5489273-5489295 GTTGTTGTTTTTATAAAAGGGGG + Intergenic
1063469600 10:6273718-6273740 GCTGATGTCCTTATAAAAAAGGG + Intergenic
1063534111 10:6865797-6865819 GCTGTTGTCTTTATAAAGGATGG - Intergenic
1063812942 10:9735166-9735188 GCAATTGTCTTTATAAAATCGGG - Intergenic
1064726774 10:18288069-18288091 ACTGGTGTCCTTATAAAAAGAGG - Intronic
1065158971 10:22899435-22899457 ACTAGTGTCCTAATAAAATGGGG + Intergenic
1066349879 10:34627490-34627512 ACTAACGTCCTTATAAAAAGGGG + Intronic
1067231786 10:44417280-44417302 GCTAGAGTCCTTATGAAAAGGGG - Intergenic
1067408837 10:46047231-46047253 GCTAGTGTCCTTATCAGAAGAGG - Intergenic
1068807286 10:61211970-61211992 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
1068824636 10:61421541-61421563 ACTATTGTCCTTATAAGAAAAGG + Intronic
1068881690 10:62056072-62056094 GCTATTTTAATTGTAAAAGGGGG - Intronic
1069397046 10:68000710-68000732 TTTTGTGTCCTTATAAAAGGGGG + Intronic
1069403792 10:68076728-68076750 TCTGGTGTCCTTATAAAAGAGGG - Intergenic
1069576957 10:69537588-69537610 ACTGCTGTCCTTATAAAAAGGGG - Intergenic
1069760396 10:70806713-70806735 ACTGGTGTCCTTATAAAATGGGG - Intergenic
1069980091 10:72246495-72246517 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1071037723 10:81267132-81267154 GCTTATGTTCTTATAAAAAGAGG - Intergenic
1072207562 10:93217777-93217799 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
1072516691 10:96190373-96190395 GCTGGTGTCCTTATAAAATTAGG - Intronic
1072798121 10:98372192-98372214 GATCATGTCCTTATAAAATGAGG - Intergenic
1073591197 10:104759084-104759106 ACTGATGTCCTTATAAAAGGGGG + Intronic
1074336075 10:112577162-112577184 ATTAGTGTCCTTATAAAAAGAGG - Intronic
1074432559 10:113406358-113406380 GCTGTTGTCTTTATAAGAAGAGG + Intergenic
1075084504 10:119405490-119405512 GCTCTTGACTTTATAAAATGTGG - Intronic
1075235854 10:120728040-120728062 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1075635161 10:124025749-124025771 GCAGGTGTCCTTATAAAAAGAGG + Intronic
1075669819 10:124256727-124256749 ACTGTTGTCCTTATAAGAAGAGG + Intergenic
1076167276 10:128292742-128292764 ATTAATGTCCTTATAAAAGAAGG - Intergenic
1076273758 10:129178832-129178854 ACTAGTGTCCTTACAAAAAGAGG - Intergenic
1076303041 10:129442235-129442257 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
1076327505 10:129637715-129637737 ACTAGTGTCCTTATAAGAAGAGG + Intronic
1077173334 11:1178053-1178075 CCTGGTGTCCTTATAAAAGAGGG - Intronic
1077535415 11:3121798-3121820 ACTGGTGTCCTTATAAAAAGGGG + Intronic
1077542712 11:3154986-3155008 ACTGGTGTCCTTATAAAAAGAGG + Intronic
1078435123 11:11318365-11318387 AGTAGTGTCCTTATAAAAAGGGG + Intronic
1079449059 11:20583623-20583645 ATTTGTGTCCTTATAAAAGGAGG - Intergenic
1079820889 11:25126649-25126671 GCTATTGTCCTTATAAGAAAAGG - Intergenic
1080057401 11:27920328-27920350 TCTATTGTCCTTATAATAAGAGG + Intergenic
1080208596 11:29758422-29758444 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
1080372135 11:31662332-31662354 GCTTTTGTCCACATAAAAGTGGG + Intronic
1080375696 11:31707874-31707896 ACAAGAGTCCTTATAAAAGGAGG - Intronic
1081167676 11:39826054-39826076 ACTGTTGTCCTTATAAGAAGAGG + Intergenic
1081170489 11:39863823-39863845 TCTAGTGTCCTTATAAAAGAAGG - Intergenic
1081276338 11:41153878-41153900 ACAAGTGTCTTTATAAAAGGAGG + Intronic
1082865496 11:57896540-57896562 ACTAGTGTCCTTATAAAAAGGGG - Intergenic
1083504767 11:63145898-63145920 ACTAGTGTCCTTATAAGAAGAGG - Intronic
1083700679 11:64475791-64475813 ACTAGGGTCCTTATAAGAGGAGG - Intergenic
1084092115 11:66885576-66885598 CTTAGTGTCCTTATAAAAAGGGG + Intronic
1084469041 11:69344486-69344508 GCTGTTGACCTGATAAAAAGGGG + Intronic
1085452202 11:76641185-76641207 ACTAGTGTCCTTGTAAAAAGGGG + Intergenic
1085712700 11:78844335-78844357 ACTTATGTCCTTATAAAAAGAGG + Intronic
1085758868 11:79224641-79224663 ACTAGTGTCCTTATAAAAAGGGG + Intronic
1085792665 11:79509342-79509364 ACTAATGTCCTTATAAGAGGTGG + Intergenic
1085857096 11:80187544-80187566 ACTAGTATCCTTATAAAAAGAGG - Intergenic
1085932359 11:81098747-81098769 GCTCATGTCCTTATAAAAACAGG - Intergenic
1086781888 11:90917154-90917176 GCTATTTTCCCTTTAAATGGAGG - Intergenic
1086814303 11:91349436-91349458 ACTAGTGTCCTTATAAGAAGGGG + Intergenic
1086932072 11:92704568-92704590 ACTAATGTCCTTATAAGAAGAGG + Intronic
1086980260 11:93189000-93189022 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1087004247 11:93453534-93453556 ACTAGTGTCCTTATAAAAGGGGG + Intergenic
1087279136 11:96191019-96191041 GCAATCCTCCTTCTAAAAGGGGG - Intronic
1087347853 11:96993669-96993691 TCTAGTGTCCTTATAAGAAGAGG - Intergenic
1087615544 11:100482629-100482651 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1088392858 11:109334691-109334713 ACTAGTGCCCTTATAAAAAGAGG + Intergenic
1088850207 11:113698017-113698039 GCCAGTGTCCTTATAAGAAGAGG + Intronic
1089568987 11:119389909-119389931 ACTAGTGTCCTTATAAAACAAGG - Intergenic
1090413382 11:126524195-126524217 GGTATTGTCCCCATAAAATGGGG - Intronic
1090541783 11:127714141-127714163 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
1090866513 11:130705462-130705484 ACTAGTGTTCTTATAAAAGTAGG - Intronic
1090873554 11:130769163-130769185 GCTGGTGTCCTCATAAAAAGAGG - Intergenic
1091118330 11:133035766-133035788 ACTGTTGTCCTTATAAGAAGAGG + Intronic
1091854920 12:3731756-3731778 GCTGGTGTCCTTATAAAAATGGG + Intronic
1092497198 12:9008677-9008699 ATTAGTGTCCTTATAAGAGGAGG - Intronic
1092654623 12:10672045-10672067 ACTAGTGTCCTTATAAAAAGGGG + Intronic
1092943046 12:13428182-13428204 ACTGGTGTCCTTATAAAAGGGGG + Intergenic
1093264389 12:16984618-16984640 GCTAGTGTCCTTATAAGAAGAGG + Intergenic
1093405376 12:18798074-18798096 ATTGTTGTCCTTATAAAAAGGGG + Intergenic
1093868122 12:24253015-24253037 GCTATTGTGCTTAAAAAACTTGG - Intergenic
1093881029 12:24404909-24404931 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1093915264 12:24795253-24795275 GGTATTATGGTTATAAAAGGGGG - Intergenic
1094534351 12:31307781-31307803 GATATTGCCCTCATACAAGGGGG + Intronic
1094642794 12:32292366-32292388 GCTGCTGTCTTTATAAAAAGGGG - Intronic
1094771853 12:33671676-33671698 ACTAATGTCCCTATAAAAAGAGG - Intergenic
1095676067 12:44919543-44919565 GACAGTGTCCTTATAAAAAGGGG + Intronic
1095779773 12:46046894-46046916 ACTGATGTCCTTATAAAAAGAGG + Intergenic
1095953477 12:47794098-47794120 ACTATTGTCCTTATAGGAAGAGG + Intronic
1096471890 12:51883537-51883559 ACTGTTGTCCTTATAAGAAGAGG - Intergenic
1096655625 12:53089673-53089695 ACTTGTGTCCTTATAAAAAGGGG + Intergenic
1097945212 12:65360099-65360121 ACTAGTGACCTTATAAAAAGAGG - Intronic
1098164052 12:67674698-67674720 ACTGGTGTCCTTATAAGAGGAGG + Intergenic
1098273839 12:68794177-68794199 ACTGCTGTCCATATAAAAGGGGG - Intergenic
1098435830 12:70467622-70467644 TCTGGTGTCCTTATAAAAAGGGG - Intergenic
1098561090 12:71874035-71874057 ACTAATGTCCTTATAAAAAGGGG - Intronic
1099597591 12:84687439-84687461 TCTAGTGTCTTTATAAAAGTGGG - Intergenic
1099647926 12:85383069-85383091 ACTGGTGTCCTTATAAAAGGAGG + Intergenic
1099692897 12:85982838-85982860 ACTTGTGTCCTTATAAAAAGAGG + Intronic
1099948347 12:89271364-89271386 ACTACTGTCCTTATAAGAAGAGG + Intergenic
1101006432 12:100405469-100405491 ACAATAATCCTTATAAAAGGAGG + Intronic
1101558950 12:105837715-105837737 ACTAGTGTCCTTATAAGACGAGG - Intergenic
1102023855 12:109702103-109702125 GTTATTGTCATTATACATGGAGG + Intergenic
1102412222 12:112729965-112729987 ACTGCTGTCCTTATAAAAAGGGG + Intronic
1102749324 12:115278456-115278478 GCTGATGTCCTTATAAGAAGAGG - Intergenic
1102935218 12:116890886-116890908 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
1103128603 12:118446784-118446806 ACTGTTGTCCTCATAAAAAGAGG - Intergenic
1103249212 12:119485635-119485657 ACTGGTGTCCTTATAAGAGGAGG - Intronic
1103512512 12:121484961-121484983 ATTGTTGTCCTTATAAAATGAGG + Intronic
1103791662 12:123476535-123476557 ACTGGTATCCTTATAAAAGGGGG + Intronic
1103849497 12:123922787-123922809 ACTGGTGTCCTTATAAGAGGAGG - Intronic
1104319172 12:127734244-127734266 GCTGTAGTCCTGATAAAAGTGGG + Intergenic
1104634953 12:130432601-130432623 ACTATTTTCCTTATAAAAAGAGG + Intronic
1105067873 12:133216182-133216204 GATTGTGTCCTTATAAAAAGGGG + Intergenic
1105615637 13:22009662-22009684 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1105827942 13:24139225-24139247 ACTGGTGTCCTTATAAGAGGAGG - Intronic
1106139590 13:27001094-27001116 ACTGGTGTCCTTATAAAAGGGGG + Intergenic
1106171756 13:27294704-27294726 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
1106454553 13:29915846-29915868 ACCATTGTCCTTATAAGAAGAGG + Intergenic
1106589527 13:31087546-31087568 ACTAGTGTCCTTATAAAATGGGG - Intergenic
1106752972 13:32794011-32794033 ACTGGTGTCCTTATAAAACGGGG - Intergenic
1107043704 13:35974320-35974342 GCTACTGTCCTTACACAAAGAGG + Intronic
1107214108 13:37895309-37895331 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1107252204 13:38377690-38377712 ACTGATGTCTTTATAAAAGGAGG - Intergenic
1107500100 13:40964842-40964864 CCTGGTGTCCTTATAAAAAGGGG - Intronic
1107881877 13:44839695-44839717 GCTATTATCATTGGAAAAGGTGG + Intergenic
1108115098 13:47118851-47118873 ACTAGTGTCCTTATAAAAAGGGG + Intergenic
1108551461 13:51549636-51549658 ATTAATGCCCTTATAAAAGGAGG + Intergenic
1108697404 13:52914559-52914581 ACTTGTGTCCTTATAAAAGGAGG - Intergenic
1109131148 13:58587333-58587355 ACTAATGTCCTTATGAAAAGAGG + Intergenic
1109507248 13:63319847-63319869 TCTGTTTTCCTTATAAAAAGAGG - Intergenic
1109616648 13:64842579-64842601 GCTGGTATCCTTATAAAATGGGG - Intergenic
1110146791 13:72201857-72201879 ACAATGGTCCTTATAAGAGGGGG + Intergenic
1110343770 13:74422685-74422707 GCTATTATTCTTAAAAATGGGGG + Intergenic
1110494668 13:76153107-76153129 ACTGTTGTCATTATAAAAAGAGG - Intergenic
1111102212 13:83603195-83603217 GCAAAGGTCCTCATAAAAGGAGG + Intergenic
1111253359 13:85635087-85635109 ACTAGTGTCCTTATAAGAGGAGG - Intergenic
1111709050 13:91788279-91788301 ATTAATGTCCTTATAAAAAGAGG - Intronic
1111841689 13:93457248-93457270 ACTAGTGTCTTTATAAAAAGGGG - Intronic
1112143444 13:96671707-96671729 ACTAGTGTCCTTATAAAAGGGGG - Intronic
1112220383 13:97483361-97483383 ACTGGTGTCCTTATAAGAGGAGG + Intergenic
1112248606 13:97757110-97757132 GCTGATCTCCTTATAAAAAGGGG - Intergenic
1112664497 13:101554084-101554106 ACTGTTATCCTTATAAAAAGGGG - Intronic
1112866665 13:103909687-103909709 ACTCATGTCCTTATAAAAAGAGG + Intergenic
1113392932 13:109915426-109915448 ACTAATGTCCTTAGAAAAAGGGG + Intergenic
1113399495 13:109977948-109977970 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1114404520 14:22443613-22443635 ACTGATGTCCTTATAAGAGGAGG - Intergenic
1114509785 14:23248746-23248768 ATTAGTGTCCTTATAAAAAGAGG - Intronic
1115452963 14:33569832-33569854 GTTCTTGTCCTTATAAACAGGGG + Intronic
1116427123 14:44804982-44805004 ACTATTGTCCTTATAAAAAGAGG + Intergenic
1118715767 14:68558687-68558709 GCTGGTGTCCTTATAAGAAGAGG - Intronic
1119148436 14:72336917-72336939 ACTGATGTCCTTATAAAAAGGGG - Intronic
1119639785 14:76305920-76305942 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1119816503 14:77573555-77573577 GCTAATGTCTTTATAGAAAGGGG + Intronic
1120324406 14:83007042-83007064 ACTGTTGGCCTTATAAGAGGAGG - Intergenic
1120390259 14:83898021-83898043 ACTAGTGTTCTTATAAAAAGGGG + Intergenic
1120422753 14:84309048-84309070 ACTAATGTCCTTACAAAAAGAGG + Intergenic
1120472467 14:84943688-84943710 ACTAGTGCCCTTATAAAAGAGGG - Intergenic
1120517127 14:85484159-85484181 GCTATTGTCCCTTCAAGAGGAGG + Intergenic
1120865681 14:89293576-89293598 GACGTTGTCCTTAGAAAAGGTGG - Intronic
1120932386 14:89861718-89861740 ACTATTGGCTTTATAAAAAGAGG + Intronic
1121454470 14:94029531-94029553 ACTGGTGTCCTTATAAAAAGAGG - Intronic
1121561956 14:94882493-94882515 ACTGTTGTCCTTATAAGAAGAGG + Intergenic
1121683419 14:95813611-95813633 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1122095386 14:99366702-99366724 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1122166341 14:99827195-99827217 GCTAGTGTCCTTATAAGAAGAGG + Intronic
1122730549 14:103793984-103794006 ACTAGTGTCCTTACAAGAGGGGG + Intronic
1123176151 14:106421148-106421170 GCTGTTGTCTTTATAAGAAGAGG - Intergenic
1123393933 15:19907144-19907166 GATTTACTCCTTATAAAAGGAGG + Intergenic
1123674834 15:22700340-22700362 ACTAGTGTTCTTATAAAAAGGGG - Intergenic
1124326848 15:28773320-28773342 ACTAGTGTTCTTATAAAAAGGGG - Intergenic
1124422710 15:29536741-29536763 ACTGGTGTCCTTATAAAAAGGGG + Intronic
1124507324 15:30289670-30289692 CCTGGTGTCCTTATAAAAAGGGG - Intergenic
1124736231 15:32248989-32249011 CCTGGTGTCCTTATAAAAAGGGG + Intergenic
1124984602 15:34594579-34594601 ATTAATGTCCTTATAAAAAGAGG - Intergenic
1125563522 15:40657739-40657761 ACTAGTGTCCTTATAAAAAGGGG - Intronic
1126333536 15:47560780-47560802 TATTGTGTCCTTATAAAAGGGGG + Intronic
1126345834 15:47693156-47693178 ACTGTTGTCCATATAAAAGAAGG + Intronic
1126910745 15:53414809-53414831 ACCAATGTCCTTGTAAAAGGTGG - Intergenic
1127213088 15:56795553-56795575 GCTGGTGTCTTTATAAAAAGAGG - Intronic
1127621495 15:60738954-60738976 ACTGGTGTCCTTATAAAAGGGGG - Intronic
1127845600 15:62867891-62867913 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1127862657 15:63007239-63007261 GCTGGTGTCCTTATAAGAAGAGG + Intergenic
1128396378 15:67230420-67230442 ACTGTTGTGCTTATAAAAAGGGG + Intronic
1129923095 15:79337301-79337323 ACTGTTGTCCTTATATAAAGGGG - Intronic
1130057352 15:80537944-80537966 ACTGATGTCCTTATAAAAGGGGG + Intronic
1130249405 15:82287567-82287589 ACTGATGTCCTTATAAAAAGGGG - Intergenic
1130450660 15:84048566-84048588 ACTGATGTCCTTATAAAAAGGGG + Intergenic
1131040203 15:89257590-89257612 ACTAATGCCCTTATAAAAAGGGG - Intronic
1131545934 15:93315494-93315516 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1131547734 15:93329969-93329991 ACCAGTGTCCTTATAAAAAGAGG - Intergenic
1131564753 15:93476041-93476063 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1131938230 15:97531791-97531813 ACTGATGTTCTTATAAAAGGGGG - Intergenic
1132179790 15:99743648-99743670 ACTGTTGTCCTTATAAGAAGAGG + Intergenic
1132196232 15:99916553-99916575 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1132216311 15:100064103-100064125 ACTGATGTCCTTATAAAAAGGGG + Intronic
1132384264 15:101389063-101389085 ACCAGTGTCCTTATAAAAAGAGG + Intronic
1133693994 16:8243384-8243406 GCTCATGTCCTCATAAATGGTGG - Intergenic
1133893618 16:9904676-9904698 ACTAATGCCCTTATAAAAAGAGG - Intronic
1133907667 16:10036823-10036845 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1134103279 16:11467923-11467945 CCTGGTGTCCTTATAAAAAGGGG + Intronic
1134782193 16:16908284-16908306 ACTAGTGTCCTTATAATAAGAGG - Intergenic
1134840645 16:17399021-17399043 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1134855128 16:17512170-17512192 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1135080434 16:19429867-19429889 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1135229763 16:20694842-20694864 ACTGGTGTCCTTATAAAAAGAGG + Intronic
1135685850 16:24497844-24497866 ACCACTGTCCTTATAAAAAGGGG + Intergenic
1136699947 16:32125022-32125044 GATTTACTCCTTATAAAAGGAGG + Intergenic
1136767706 16:32802451-32802473 GATTTACTCCTTATAAAAGGAGG - Intergenic
1136800444 16:33068246-33068268 GATTTACTCCTTATAAAAGGAGG + Intergenic
1136868578 16:33778218-33778240 GATTTACTCCTTATAAAAGGAGG + Intergenic
1136902827 16:34058576-34058598 GATTTACTCCTTATAAAAGGAGG + Intergenic
1136958331 16:34811974-34811996 GATTTACTCCTTATAAAAGGAGG + Intergenic
1137521997 16:49202397-49202419 ACTGGTGTCCTTATAAAATGAGG + Intergenic
1138173140 16:54871732-54871754 ACTAGTGTCCTTATAAAAAGGGG + Intergenic
1138211613 16:55167760-55167782 CCAAATGTCCTTATAAAAGAAGG + Intergenic
1138372177 16:56535985-56536007 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1139350828 16:66334237-66334259 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1140024647 16:71274805-71274827 GCTGGTGTCCTTATGAAAAGGGG + Intergenic
1140631365 16:76856586-76856608 GTTAGTGGCCTTATAAGAGGAGG - Intergenic
1140807430 16:78545873-78545895 ACTGGTGTCCTTATAAGAGGAGG - Intronic
1140948290 16:79791769-79791791 GCTGGTGTCCTTATAAAAAAAGG - Intergenic
1141023718 16:80523121-80523143 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1141821198 16:86447224-86447246 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1203070099 16_KI270728v1_random:1064480-1064502 GATTTACTCCTTATAAAAGGAGG - Intergenic
1203103599 16_KI270728v1_random:1337855-1337877 GATTTACTCCTTATAAAAGGAGG - Intergenic
1203129915 16_KI270728v1_random:1624513-1624535 GATTTACTCCTTATAAAAGGAGG + Intergenic
1143914788 17:10282235-10282257 ACTAGTGTCCTAATAAAAAGGGG - Intergenic
1146203679 17:30882736-30882758 GCTATTGAGCTTTTAAAATGTGG + Intronic
1148162666 17:45460010-45460032 ACTGATGTCCTTATAAGAGGAGG + Intronic
1148397099 17:47317769-47317791 ACAAGTGTCCTTATAAGAGGGGG + Intronic
1148971884 17:51490903-51490925 GTTAGTGCCCTTATAAAAGAGGG + Intergenic
1150393894 17:64806675-64806697 ACTGATGTCCTTATAAGAGGAGG + Intergenic
1150892712 17:69172385-69172407 ACTATTGTCCTTATAAGAAGGGG + Intronic
1151178861 17:72311318-72311340 GCTGGTGTCCTTATAAAAAAGGG + Intergenic
1151183650 17:72348110-72348132 ACTGATGTCCTTATAAAAGGAGG + Intergenic
1151871131 17:76837700-76837722 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
1152704835 17:81837846-81837868 ACTGGTGTCCTTATACAAGGGGG - Intergenic
1152908532 17:82983899-82983921 ACTGTTGTCCTTATAAGAAGAGG + Intronic
1153082091 18:1238988-1239010 ACTAGTGTCCTTATAAGATGAGG - Intergenic
1153087494 18:1304634-1304656 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
1153237148 18:2999285-2999307 ACTGATGTCCTTATAAAAAGAGG + Intronic
1153274113 18:3351241-3351263 GTTAATTTCCTTTTAAAAGGAGG - Intergenic
1153619554 18:6964381-6964403 ACAGTTGTCCTTATAAAAAGGGG + Intronic
1153655740 18:7280619-7280641 ACTGATGTCCTTATAAAAAGAGG - Intergenic
1154129606 18:11725268-11725290 CCTGTTGTCCTTATAAGAAGAGG + Intronic
1154517201 18:15185239-15185261 GATTTACTCCTTATAAAAGGAGG - Intergenic
1155129283 18:22914536-22914558 GCTATAGTCATTTTAAAAGCTGG + Intronic
1155193067 18:23448464-23448486 ACTAGTGGCCTTATAAAAAGAGG - Intergenic
1155437395 18:25827434-25827456 ACTGGTGTCCTTATAAACGGGGG - Intergenic
1155491126 18:26402982-26403004 ACTGGTGTCCTTATAAGAGGAGG + Intergenic
1155755059 18:29482566-29482588 GCTATTTTCTTATTAAAAGGAGG + Intergenic
1155883181 18:31176148-31176170 ACTAATGTCCTTATATAAAGGGG - Intergenic
1155939746 18:31791330-31791352 ACTAGTGTCCTTGTAAGAGGAGG + Intergenic
1156006613 18:32449996-32450018 GCTAGTGTTCTTACATAAGGAGG - Intronic
1156038305 18:32791154-32791176 GGTATTGTACTTATAAATTGGGG + Intergenic
1156287915 18:35717132-35717154 ACTAGTGTCCTTATAAGAGGAGG - Intergenic
1156511148 18:37637863-37637885 GCTATGGTGCTGATAAAATGTGG + Intergenic
1156617930 18:38810088-38810110 ACTAGTGTCCTTATAAAAAGAGG - Intergenic
1156834026 18:41530786-41530808 ACTATTGTCCTTATCAAAAAGGG + Intergenic
1157017568 18:43735737-43735759 GCTAATGTCCTTATAAGGAGAGG - Intergenic
1157173756 18:45432156-45432178 GCTATTTTTATTATAAAAGATGG - Intronic
1157504472 18:48216945-48216967 ACTGGTGTCCTTATAAAAAGGGG + Intronic
1157755932 18:50217987-50218009 GCTGGTGTCCTTATAAAAGGAGG - Intergenic
1157961190 18:52155091-52155113 ACTGCTGTCCTTATAAAAAGGGG - Intergenic
1158556017 18:58475350-58475372 ACTGCTGTTCTTATAAAAGGGGG + Intergenic
1160023238 18:75197113-75197135 GCTATCCCCCTTGTAAAAGGAGG - Exonic
1160043751 18:75368478-75368500 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1160091023 18:75826597-75826619 ACTAGTGTCCTTATAAAAGTGGG - Intergenic
1161163340 19:2772686-2772708 ACCAATGTCCTTATAAAAAGGGG + Intronic
1161757411 19:6144352-6144374 ACCAGTGTCTTTATAAAAGGAGG + Intronic
1161822281 19:6537217-6537239 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1161822583 19:6539401-6539423 ACTGATGTTCTTATAAAAGGGGG + Intergenic
1162041893 19:7975795-7975817 ACTGATGTCCTTATAAAAGAGGG + Intronic
1162456995 19:10791394-10791416 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1162895062 19:13760384-13760406 ATTATTGGACTTATAAAAGGAGG - Intronic
1163749930 19:19070597-19070619 ACTAGTGTCCTTATAAGAAGAGG - Intronic
1166880105 19:45923910-45923932 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
1167255926 19:48428669-48428691 ACTAGTGTCCTTATAAAAAGGGG - Intronic
1167548775 19:50145136-50145158 ACAAGTGTCCTTATAAGAGGGGG + Intergenic
1167772256 19:51528670-51528692 ACTGTTGTCCTTATAAAAAGGGG + Intronic
925473823 2:4191294-4191316 GCTGGTGTCCTTATAAGAAGAGG + Intergenic
925529694 2:4845591-4845613 GCTGTTGTCTTTATAAGAAGAGG + Intergenic
925863512 2:8203035-8203057 ACTAGTGTCCTTCTAAAAAGGGG - Intergenic
925983577 2:9196799-9196821 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
926778280 2:16443787-16443809 GCTGGTGCCCTTATAAGAGGAGG - Intergenic
928395865 2:30942949-30942971 ACTGGTGTCCTTATAAAAAGGGG + Intronic
928607278 2:32954498-32954520 ACTGATGTCCTTATAAAAAGGGG - Intronic
929833863 2:45375937-45375959 ACTGTTGTCCTTATAAAAAGGGG - Intergenic
929897591 2:45975483-45975505 ATTAGTGTCCTTATAAGAGGAGG - Intronic
929933237 2:46274783-46274805 GTTAGTGCCCTTATAAAAAGAGG + Intergenic
930001506 2:46864831-46864853 GTTAGTGCCCTTATAAAAGGAGG - Intergenic
930132882 2:47870465-47870487 ACTAGTGTCCTCATAAAAAGAGG + Intronic
930257633 2:49110259-49110281 GTTTTTGTACTTATAAAATGTGG - Intronic
930606888 2:53502155-53502177 ACTGGTGTCCTTATAAAATGGGG - Intergenic
931079007 2:58748013-58748035 GCTACTGCCCTGATAAAAGCAGG - Intergenic
931570604 2:63665433-63665455 ACTGGTGTCCTTATAAAAAGGGG - Intronic
931636145 2:64342144-64342166 AATGTTGTCCTTATAAAAAGGGG + Intergenic
931778202 2:65557647-65557669 ACTGGTGTCCTTATAAAAGCGGG - Intergenic
933366982 2:81365323-81365345 GCTATTTTCTCTCTAAAAGGAGG + Intergenic
933544323 2:83691359-83691381 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
933655763 2:84885763-84885785 ACTGGTGTCCTTATAAAAAGAGG + Intronic
933983429 2:87572131-87572153 ACTGGTGTCCTTATAAAAGGGGG - Intergenic
934040232 2:88122276-88122298 TCTGGCGTCCTTATAAAAGGGGG - Intergenic
934917934 2:98315679-98315701 AAAACTGTCCTTATAAAAGGTGG + Intergenic
934994998 2:98949741-98949763 ACTGATGTCCTTATAAAAAGGGG + Intergenic
935104635 2:100029257-100029279 ACTGGTGTCCTTATAAGAGGAGG + Intronic
935185587 2:100729584-100729606 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
935237989 2:101153757-101153779 ACTGGTGTCCTTATAAAAAGAGG + Intronic
935280357 2:101512052-101512074 GCTGGTGTCCTTATAAGAAGAGG + Intergenic
935455901 2:103267720-103267742 GCTGGTGTTCTTATAAAATGGGG + Intergenic
935796384 2:106645260-106645282 GCTGATGTCCTTATAAGAGGAGG - Intergenic
935945731 2:108284987-108285009 ACTGATATCCTTATAAAAGGGGG + Intergenic
936310420 2:111378663-111378685 ACTGGTGTCCTTATAAAAGGGGG + Intergenic
936821486 2:116527495-116527517 ACTGGTGTCCTTATGAAAGGGGG - Intergenic
936895741 2:117425500-117425522 ACTGGTGTCCTTATAAAACGAGG + Intergenic
937269028 2:120635730-120635752 ACTAGTGTCCTTATAAGACGAGG + Intergenic
937565804 2:123286982-123287004 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
937773474 2:125748567-125748589 ACCACTGTCCTTATAAAAAGAGG - Intergenic
938517533 2:132030170-132030192 GATTTACTCCTTATAAAAGGAGG - Intergenic
938565915 2:132518901-132518923 GCTATTGTTCATTTGAAAGGAGG - Intronic
938652354 2:133396630-133396652 ACTGATGTCCTTATAAAAAGGGG - Intronic
939283843 2:140102238-140102260 ACTGATGTCTTTATAAAAGGAGG + Intergenic
939609365 2:144291133-144291155 ACTGGTGTCCTTATAAAAAGGGG - Intronic
939641709 2:144647665-144647687 TCTAGTGTCTTTATAAAAAGAGG + Intergenic
940952712 2:159694131-159694153 ACTGGTGTCCTTATAAGAGGAGG + Intergenic
940989068 2:160079660-160079682 CCTGGTGTCCTTATAAAAAGAGG + Intergenic
940991262 2:160098951-160098973 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
941043039 2:160644739-160644761 ACTGGTGTCCTTATAAGAGGAGG + Intergenic
941874296 2:170417750-170417772 GATGATGTCCTTATAAAAAGGGG - Intronic
941976042 2:171406561-171406583 ACTGGTGTCCTTATAAAAAGAGG - Intronic
942326927 2:174783579-174783601 GCTGATATCCTTATAAGAGGAGG - Intergenic
943610407 2:190026533-190026555 CCTATTGTCCTTATAAGAGCTGG + Intronic
943631207 2:190254263-190254285 ACTGGTGTCCTTATAAGAGGAGG + Intronic
943910888 2:193566015-193566037 ACTAGTATCCTTATAAAAGGGGG + Intergenic
944150136 2:196548892-196548914 ACTGGTGTCCTTATAAAAAGGGG - Intronic
944841121 2:203624534-203624556 ACTGATGTCCTTATAAAAAGGGG - Intergenic
944965808 2:204931533-204931555 GCCATTGTCCTTGTAACATGGGG + Intronic
945257936 2:207817988-207818010 GTTATTGACCTCATAAAGGGAGG + Intergenic
945458071 2:210071576-210071598 ACTGATGTCCTTATAAAAAGGGG - Intronic
945910831 2:215647259-215647281 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
945990964 2:216394951-216394973 ACTAGTGTCCTTATAAAAAGGGG + Intergenic
946013109 2:216582512-216582534 ACTGATGTCCTTATAAAAAGAGG - Intergenic
946088375 2:217197197-217197219 ACTAGTGTCCTTATAAGATGGGG - Intergenic
946493248 2:220170629-220170651 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
946930764 2:224668285-224668307 ATTGTTGTCCTTACAAAAGGGGG + Intergenic
946961072 2:224986576-224986598 ACTAATGTCCTTATAAGAAGAGG + Intronic
947321693 2:228926328-228926350 GCTGGTGTCCTTATAAAACGGGG + Intronic
947499623 2:230662406-230662428 ACTGATGTCCTTATAAAAAGAGG - Intergenic
947803233 2:232945435-232945457 GCTGGTGTCTTTATAAGAGGAGG + Intronic
948355701 2:237375228-237375250 ACAAGTGTCCTTATAAGAGGGGG + Intronic
948436746 2:237958911-237958933 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
948761738 2:240196650-240196672 GCGAGTGTCCTTATAAGATGGGG + Intergenic
1168780143 20:482319-482341 GCTATTGTGCTTAAAAAACTAGG + Exonic
1170102349 20:12716228-12716250 ACTGCTGTCCTTATAAAAAGGGG + Intergenic
1170277280 20:14605401-14605423 ACTGATGTCCTTATAAAAAGGGG - Intronic
1171152969 20:22844100-22844122 GCTGTTGTCCTTTTAAAAAGGGG + Intergenic
1172893928 20:38286405-38286427 CCTGGTGTCCTTATAAAAAGGGG - Intronic
1173319241 20:41972666-41972688 GCTGTTCTCCTTTTGAAAGGAGG + Intergenic
1175507644 20:59497190-59497212 ACTGGGGTCCTTATAAAAGGGGG - Intergenic
1175582914 20:60114240-60114262 GCCAATGTCCTTATAAGAAGAGG + Intergenic
1175666071 20:60861128-60861150 ACTATTGTGCTTATAAAAAGAGG + Intergenic
1175757621 20:61539499-61539521 GCTGGCGTCCTTATAAGAGGAGG - Intronic
1175860298 20:62146934-62146956 ACTAGAGTCCTTATAAAAAGTGG - Intronic
1176685429 21:9844655-9844677 GATATTTCCCTTAGAAAAGGTGG + Intergenic
1176996594 21:15562021-15562043 ACTAGTGTCCTTATAAAAAGAGG - Intergenic
1177311376 21:19398960-19398982 ACTAGTGTCCTTATAAATAGTGG - Intergenic
1177460349 21:21400859-21400881 GCACTAGTCCATATAAAAGGTGG - Intronic
1177548807 21:22594591-22594613 ACTAGTGTCCTCATAAAAAGGGG - Intergenic
1177644075 21:23879761-23879783 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1177677504 21:24320594-24320616 ACTAGTGGCTTTATAAAAGGTGG + Intergenic
1177714190 21:24817827-24817849 ATTAGTGTCCTTATAAAAGGAGG + Intergenic
1178476440 21:32941412-32941434 GCTGCTGTCCTTATGAAAAGGGG - Intergenic
1178599861 21:33986035-33986057 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1178763120 21:35423021-35423043 ACTGATGTCCTTATAAAAAGAGG + Intronic
1178772049 21:35514622-35514644 ACCAGTGTCCTTATAAAAAGGGG + Intronic
1178818648 21:35954817-35954839 GCTTTTCTCCTTAAAAAAGAGGG + Intronic
1178839179 21:36125063-36125085 ACTAATGTCCTTATAAGAAGAGG + Intergenic
1179010482 21:37552491-37552513 ACTAGTGTCCTTATAAAAATGGG + Intergenic
1179062031 21:37988230-37988252 TCTAGTGTCCTTATAAGAAGAGG - Intronic
1179112720 21:38461297-38461319 ACTGATGTCCTTATAAAAAGAGG - Intronic
1179169658 21:38962965-38962987 GCTGGTGTGCTTATAAAAAGGGG + Intergenic
1179184287 21:39072525-39072547 ACTGATGTCCTTATAAAAGGGGG + Intergenic
1179257608 21:39730283-39730305 GTGATTGTCCTTATAAAAAGGGG - Intergenic
1179479794 21:41669920-41669942 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1179496707 21:41776442-41776464 GCTAGTGTCCTTGTAAAGAGGGG + Intergenic
1179588656 21:42390417-42390439 GCTGTTGCCCTTATAAAAAGGGG + Intronic
1179718868 21:43304281-43304303 GCTGGTGTCCTTATAAAGAGAGG + Intergenic
1181349300 22:22244052-22244074 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1181429178 22:22867471-22867493 ACTCATGTCCTTATAAAAAGGGG - Intronic
1181911648 22:26243098-26243120 ACTGGTGTCCTTATAAGAGGAGG - Intronic
1182670848 22:31994577-31994599 ACTGTTGTCCTAATAAAAAGGGG - Intergenic
1182756476 22:32683661-32683683 ACTGTTGTCCTTATAGAAGACGG - Intronic
1182901325 22:33900737-33900759 ACTGCTGTCCTTATAAAAAGGGG + Intronic
1183020688 22:35023836-35023858 ACTGGTGTCCTTATAAGAGGAGG - Intergenic
1183198737 22:36371296-36371318 GCTGGTGTCCTTATAAGACGAGG + Intronic
1183273890 22:36879205-36879227 ACTTGTGTCCTTATACAAGGGGG - Intergenic
1183313676 22:37125445-37125467 GATAGTGTCCTGATAAAAGTTGG - Intergenic
1184372666 22:44092542-44092564 GCCATTGTCCTTATGAAGGATGG + Intronic
1184583943 22:45435195-45435217 GCTGGTGTCCTTATGAAAAGGGG - Intergenic
949167501 3:959793-959815 ACTGATGTCCTTATAAAAAGGGG + Intergenic
949297148 3:2538099-2538121 ACTGGTGTCCTTATAAAAGGGGG + Intronic
949420156 3:3856877-3856899 ACTAGTGTCCTTATAAGAAGAGG - Intronic
949542642 3:5045844-5045866 ACTAGTGTCTTTATAAAAAGAGG + Intergenic
949732742 3:7132616-7132638 TCTTTTATTCTTATAAAAGGAGG - Intronic
949840480 3:8314650-8314672 GCTATTGTCCTTACAAGAAGAGG + Intergenic
950844466 3:16001059-16001081 ACTGTTGTCCTTATACAAAGGGG - Intergenic
950969463 3:17171630-17171652 GCTGGTGTCCTTATAAGAAGAGG - Intronic
951373976 3:21889978-21890000 ACTAGTGTCTTTATAAAAAGGGG - Intronic
951671097 3:25182857-25182879 GACTATGTCCTTATAAAAGGGGG + Intronic
952017599 3:28976633-28976655 GACAGTGTCCTTATAAAAAGGGG - Intergenic
952101412 3:30017468-30017490 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
952239770 3:31519021-31519043 ACTAGTGTCCTCATAAAAAGAGG - Intergenic
952678751 3:36066384-36066406 ACCAGTGTCCTTATAGAAGGGGG + Intergenic
953190770 3:40685493-40685515 ACTGTTGTCCTTACAAAAAGAGG - Intergenic
953382978 3:42488085-42488107 ACTGATGTCCTTATAAAAAGGGG + Intergenic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
954120061 3:48492533-48492555 ATTAGTGTCCTTATAAAAAGAGG + Intronic
955081891 3:55665480-55665502 ACTGTTGTCCTTATAAGAAGGGG + Intronic
955164975 3:56502036-56502058 ACTGGTGTCCTTATGAAAGGAGG - Intergenic
955817838 3:62864640-62864662 ACTGATGTCCTTATAAAATGGGG - Intronic
956389593 3:68757281-68757303 ACTGATGTCCTTATAAAAAGGGG - Intronic
956752361 3:72353430-72353452 ACTAATGTCCTTATAAAAAAGGG + Intergenic
957589727 3:82180411-82180433 ACTAGTGTCCTTATAAAAAGAGG - Intergenic
957973733 3:87416855-87416877 GCTAGTGTTCTTATAAAATGAGG + Intergenic
958424854 3:93968257-93968279 TCTGGTGTCCTTATAAAAAGGGG + Intronic
958472758 3:94542205-94542227 ACAATTGTTCTTATAAAAGTAGG - Intergenic
959230790 3:103648216-103648238 CCTTTTGTCCTTACATAAGGAGG - Intergenic
959713917 3:109412481-109412503 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
959821475 3:110740212-110740234 GCTGGTGTCCTTATAAGAAGAGG + Intergenic
960344087 3:116511023-116511045 ACTGATGTCCTTATAAAAAGGGG + Intronic
960457068 3:117885229-117885251 ATTGTTGTCCTTATAATAGGGGG - Intergenic
960908561 3:122625618-122625640 ACTAATGTCCTTATAAGAAGAGG + Intronic
961008527 3:123421003-123421025 ACTGGTGTCCTTATAAAAAGGGG - Intronic
961130311 3:124460120-124460142 ACTGATGTCCTTACAAAAGGAGG - Intronic
961352863 3:126315171-126315193 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
961958993 3:130834275-130834297 ACTAGTGTCCTTATAAAAAGGGG - Intergenic
962043344 3:131730614-131730636 ACTAATGTCCTTATAAAAATGGG + Intronic
962282419 3:134061918-134061940 GCTGGTGTCCTTATAAGAAGAGG - Intergenic
962613524 3:137101961-137101983 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
962885928 3:139627761-139627783 GCTTTTGTCCCCATAAAAGCAGG - Intronic
962960221 3:140304499-140304521 ATTAGTGTCCTTATAAGAGGAGG - Intronic
963218020 3:142772984-142773006 ACTAGTGTCTTTATAAAAGAGGG - Intronic
963302968 3:143619624-143619646 GCTATTGTCCTGGTAAAATGAGG - Intronic
963474060 3:145780959-145780981 GCTTTTGTCATTAAAAGAGGAGG - Intergenic
964498092 3:157316879-157316901 GATAGTTTCCTTATAAAAGAAGG - Intronic
965149428 3:164951232-164951254 ACTGGTGTCTTTATAAAAGGGGG - Intergenic
965609493 3:170529795-170529817 ACTGATGTCCTTATAAAAAGGGG + Intronic
966069747 3:175861237-175861259 ACTAATGTCCTTATAAGAAGAGG + Intergenic
966223118 3:177570070-177570092 ACTGATGTCCTTATAAGAGGAGG - Intergenic
966387107 3:179410594-179410616 GCTATTGTCCTTATAAAAGGGGG - Intronic
966436055 3:179885335-179885357 ACTGGTGTCCTTATAAAAAGGGG + Intronic
966464514 3:180215068-180215090 ACAAATGTCCTTATAAAGGGAGG - Intergenic
966733171 3:183167568-183167590 ACTAATGTCCTTATAAGAAGAGG - Intergenic
967281346 3:187826983-187827005 ACTGATGTCCTTATAAAAGGGGG + Intergenic
967360631 3:188626656-188626678 GGAGTTGTCCTTATAAAAAGAGG - Intronic
967674585 3:192281354-192281376 ACTAGTGTCCTTATAAAAGAAGG - Intronic
967817042 3:193808441-193808463 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
968027685 3:195456285-195456307 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
969286039 4:6202362-6202384 CCTTCTATCCTTATAAAAGGGGG + Intergenic
969965691 4:10993082-10993104 ACTATTGTCTTTATTAAAAGAGG + Intergenic
970137517 4:12941832-12941854 ACTAGTATCCTTATAAGAGGAGG + Intergenic
970492696 4:16591081-16591103 GCTATAATCCTTTTTAAAGGGGG + Intronic
970907221 4:21230079-21230101 GCTGGTGTCCTTATAAGGGGAGG + Intronic
970946774 4:21702286-21702308 ATTAGTGTCCTTATAAGAGGAGG - Intronic
971485180 4:27152679-27152701 ACTATTGACCTGATAGAAGGAGG - Intergenic
971805390 4:31351801-31351823 ACTAGTGTCCTTATAATAAGAGG + Intergenic
971946736 4:33288020-33288042 ACAAATGTCCTAATAAAAGGAGG - Intergenic
972174644 4:36388610-36388632 GCTGATGTCCTTATAAGAAGAGG - Intergenic
972380074 4:38511321-38511343 GGTAGTGTCCTTATAAGAAGAGG - Intergenic
972574290 4:40337892-40337914 GCTGGTGTCCTTATAGAAAGGGG - Intronic
973173046 4:47168963-47168985 GCTGGTGTCCTTACAAAAGGGGG - Intronic
973707721 4:53596782-53596804 GTCATTGTCATTATAATAGGGGG - Intronic
973724946 4:53765782-53765804 ACTGTTGTCCTTATAAGAAGAGG + Intronic
973942337 4:55923761-55923783 GCTCCTCTCCTTATAACAGGAGG - Intergenic
973971508 4:56218074-56218096 GCTGATGTCCTTGTAAAAAGGGG - Intronic
974083656 4:57237394-57237416 ACTATTGTCCTTAGGAAAAGAGG + Intergenic
974223075 4:59002130-59002152 ACTATTGTCCTTACAAAGAGAGG + Intergenic
974884311 4:67798217-67798239 ACTGTTGTCCTTAAAAGAGGAGG - Intergenic
975210642 4:71696038-71696060 ACTAGTGTCCTTATGAAAAGGGG - Intergenic
975481251 4:74882622-74882644 ACTGTTGTTCTTATAAAAAGGGG + Intergenic
975600425 4:76094018-76094040 GCTAATGTCCTTATAAGAAGAGG + Intronic
976574005 4:86647741-86647763 ACTAGTGTCCTTATAAGAAGAGG + Intronic
976678788 4:87732494-87732516 ACTAGTGTCCTTATAAAAAACGG + Intergenic
976785087 4:88810432-88810454 ACTAATGTCCTTATAAAAAGGGG + Intronic
976803320 4:89018244-89018266 ACTAGTGTCCTTATAAGAAGAGG + Intronic
976816865 4:89158983-89159005 CATTTTGTCCTTATGAAAGGCGG - Intergenic
977055617 4:92186960-92186982 ACTGTTGTTCTTATAAAAAGGGG - Intergenic
977212826 4:94241415-94241437 ACTGTTGTCCTTATAAAAAGGGG - Intronic
977737832 4:100439111-100439133 GATGTGGTCCTTATAAAATGTGG + Intronic
978127280 4:105149361-105149383 GCTATTTTCAGTATAAAAGTAGG - Intronic
978589822 4:110313016-110313038 ACTAGTATCCTTATAAAAAGGGG - Intergenic
978655481 4:111061052-111061074 GCTATTTTCCTTGTAAAACTGGG - Intergenic
979033437 4:115680567-115680589 GCTAGTGTCCTTATAAAGAGAGG + Intergenic
979728901 4:123997932-123997954 ACTGTTGTTCTTATAAAAAGAGG - Intergenic
980210165 4:129776981-129777003 GCTATTGAACATATAAAATGTGG + Intergenic
980281205 4:130722611-130722633 ACTGTTGTCCTTATAAAAAAAGG + Intergenic
980396295 4:132220312-132220334 ACTTGTGTCTTTATAAAAGGGGG - Intergenic
980812548 4:137901415-137901437 GCTGGTGTCCTTATAAGAAGAGG - Intergenic
981271455 4:142850886-142850908 ACTGGTGTCCTTATAAGAGGAGG - Intergenic
981497645 4:145411843-145411865 ACTAATGCCCTTGTAAAAGGAGG + Intergenic
981547828 4:145912623-145912645 ACTGGTGTCCTTATAAAAGGGGG + Intronic
981593092 4:146387155-146387177 ACTAGTGTCCTTATAAGAAGAGG + Intronic
982080343 4:151783544-151783566 ACTGTTGTCCTTATAAGAAGAGG - Intergenic
982951525 4:161702995-161703017 GTTGATGTCCTTATAAGAGGAGG + Intronic
983459889 4:168014884-168014906 ACAATTGTCCTTATAGGAGGAGG - Intergenic
983719653 4:170833764-170833786 GCTATTATCCATATAAGACGTGG + Intergenic
984024669 4:174528890-174528912 GCTAGTGTCCTTATAAGAAGAGG - Intergenic
984158046 4:176216200-176216222 GTTCATGTCCTTATAAAATGGGG + Intronic
984336679 4:178401283-178401305 GCTGGTGTCCTTATAAAAAGAGG + Intergenic
984705759 4:182846024-182846046 ACTAAAGTCCTTATAAAAAGGGG - Intergenic
984821852 4:183889268-183889290 ACTGGTGTCCTTATAAAAAGGGG + Intronic
984896387 4:184545004-184545026 ACTAGTGTCCTTATAAGAGGAGG + Intergenic
985066870 4:186131041-186131063 GTTAGTGTCCTTATAAGAAGAGG + Intronic
985993535 5:3583541-3583563 GCTAATGACCTTATAAGAAGGGG + Intergenic
986660652 5:10057094-10057116 GATGGTGTCCTTATAAATGGTGG + Intergenic
986673847 5:10166955-10166977 GCTGGTGTCCTTACAAGAGGAGG + Intergenic
986804131 5:11292352-11292374 GCTGGAGTCCTTCTAAAAGGAGG + Intronic
986972813 5:13356973-13356995 TCTGTTGTCCTTATAAGAAGAGG + Intergenic
987639485 5:20594435-20594457 ACTGATGTCCTTATAAAAAGGGG - Intergenic
988112362 5:26839183-26839205 GCTATTGTGATTATGAAAGCAGG + Intergenic
988320606 5:29690431-29690453 GCTGATGTCCTTATTAAAAGTGG + Intergenic
988589418 5:32535933-32535955 CCTGGTGTCCTTATAAAAAGGGG + Intronic
988778062 5:34495104-34495126 ACTGATGTCCTTATAAGAGGAGG + Intergenic
989758290 5:44982978-44983000 ACTGCTGTCCTTATAAAAAGGGG - Intergenic
989767927 5:45108365-45108387 ACTAGTGTTCTTATAAAAAGGGG + Intergenic
990332196 5:54739178-54739200 ACTGTTGTCTTTATAAAAAGGGG + Intergenic
990786464 5:59426028-59426050 ACTGATGTCCTTATAAAAGCAGG + Intronic
991152142 5:63382917-63382939 ACTGTTGTTCTTATAAAAAGGGG + Intergenic
991700448 5:69312127-69312149 ACTAGTGTCCTTATAAATTGAGG + Intronic
992387121 5:76295338-76295360 ATTAATGTCCTTATAAAAAGAGG - Intronic
992415578 5:76549769-76549791 GCTACTGTCCTTATAAGAAAAGG - Intronic
992582982 5:78200979-78201001 ACTAGTGTCCTAATAAAAGAAGG + Intronic
993240005 5:85370218-85370240 AATGTTGTCCTTATAAAAAGTGG + Intergenic
993465086 5:88235508-88235530 ATTATTGCCCTTTTAAAAGGAGG + Intronic
993921684 5:93812947-93812969 GTTAGTGTCCTTATAAGAAGAGG + Intronic
994196484 5:96928423-96928445 ACTAGTGTCCTTATTAAAAGAGG + Intronic
994282503 5:97922287-97922309 ACTACTGTCCTTATAAGAAGAGG - Intergenic
994752987 5:103762229-103762251 TCTCTTGTCCTTAGAAGAGGTGG + Intergenic
994992692 5:107017248-107017270 AATAGTGTCCTTATAAAAAGGGG + Intergenic
995292010 5:110467996-110468018 ACTGGTGTCCTTATAAAAAGTGG - Intronic
995543500 5:113206856-113206878 GCTATTGTCATGATCAAATGAGG - Intronic
995630348 5:114126143-114126165 ACTGGTGTCCTTATGAAAGGGGG - Intergenic
995721291 5:115136259-115136281 ACTGGTGTCCTTATAAAAAGAGG + Intronic
996523651 5:124453861-124453883 GCTGGTGCCCTTATAAAAAGAGG - Intergenic
996620554 5:125496801-125496823 ACTGGTGTCCTTATAAGAGGAGG + Intergenic
998360406 5:141581115-141581137 ACCAGTGTCCTTATAAAAAGAGG + Intronic
998534739 5:142919191-142919213 ACCATTGTCCTTGTAAAAAGGGG + Intronic
998890703 5:146742795-146742817 ACTAGTGTCCTTATAAAAAGGGG + Intronic
999076340 5:148799315-148799337 ACTGGTGCCCTTATAAAAGGTGG + Intergenic
999200881 5:149815314-149815336 GCTAGTGTCCTTATCAAAAGGGG + Intronic
999508023 5:152218594-152218616 ACTGGTGTCCTTATAAACGGGGG - Intergenic
999511589 5:152257996-152258018 ACTGGTGTCCTTATAAGAGGGGG - Intergenic
1000017334 5:157289620-157289642 ACTGGTGTCCTTATAAAAAGAGG - Intronic
1000165922 5:158648621-158648643 GCTGGTGTCCTTATAAAAAGGGG + Intergenic
1000962690 5:167618961-167618983 CCAATTGTCTTTCTAAAAGGGGG - Intronic
1001180504 5:169515576-169515598 ACTAGTGTCCTTAGAAAATGGGG - Intergenic
1001186631 5:169580225-169580247 GCTACTGTCCTTATAAGAAGAGG - Intergenic
1001243510 5:170088108-170088130 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
1001341731 5:170853056-170853078 GCTGGTGCCCTTATAAAATGAGG - Intergenic
1001751043 5:174131695-174131717 GCTGGTGTCCTTATAAGAAGGGG + Intronic
1001833568 5:174810563-174810585 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1001876977 5:175210190-175210212 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
1002459290 5:179364964-179364986 ACTCTTGTCCTTATAAAAGAGGG - Intergenic
1002558316 5:180061672-180061694 ACTAATGTCCTTATAAGAAGAGG - Intronic
1002613965 5:180438881-180438903 ACTATTGCCCATATAAAAGGGGG + Intergenic
1002906428 6:1452876-1452898 ACTGATGTCCTTATAAAAAGAGG - Intergenic
1003072813 6:2958152-2958174 ACTCATGTCCTTATAAAAAGAGG + Intronic
1003143403 6:3490202-3490224 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1003272134 6:4616637-4616659 ACTGGTATCCTTATAAAAGGAGG - Intergenic
1003585050 6:7381262-7381284 ACTGGTGTCCTTATAAGAGGAGG + Intronic
1003637412 6:7845380-7845402 GTTATTGTCATGACAAAAGGTGG - Intronic
1003793739 6:9576810-9576832 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1004004035 6:11622766-11622788 GCTGCTGTCCTTATAAGAAGGGG - Intergenic
1004350995 6:14890360-14890382 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1004456133 6:15793050-15793072 ACTAGTGTCCTCATAAGAGGAGG - Intergenic
1004787679 6:18987307-18987329 ACTAATGTCCTTATAAGAAGAGG + Intergenic
1006590546 6:35152278-35152300 ACTAGTGTCCTTATAAAAAGAGG - Intergenic
1007509391 6:42363722-42363744 TCTGGTGTCCTTATAAAAAGGGG + Intronic
1008836763 6:55841732-55841754 GCTAATGTCTTTATAAAAAGAGG - Intronic
1009315369 6:62212586-62212608 ACTAGTGTCCTTATAAAAAGAGG + Intronic
1009745044 6:67800762-67800784 GTTATTGACCTTAAAGAAGGGGG + Intergenic
1013447962 6:110250379-110250401 ACTGATGTCCTTATAAAAAGAGG - Intronic
1013940155 6:115651422-115651444 ACTGCTGTCCTTATAAAAAGAGG - Intergenic
1014365955 6:120542199-120542221 ACTAGTGTCCTTATAAAAAGGGG - Intergenic
1014539982 6:122663684-122663706 ACTGGTGTCCTTATAAAAGGAGG - Intronic
1014591328 6:123275292-123275314 ACTATTGTCCTTATAAGAAGAGG + Intronic
1015022262 6:128490904-128490926 ACTGATGTCCTTATAAAAAGAGG - Intronic
1015312960 6:131784811-131784833 ACTGCTGTCCTTATAAAAGAAGG - Intergenic
1015814875 6:137198543-137198565 GCCATTTTCCTTAGAAAAGGAGG - Exonic
1016004631 6:139077004-139077026 ACTGTTGTCCTTATAAGAAGAGG + Intergenic
1016188366 6:141226791-141226813 ACTAATGTCCTTATAAGAAGAGG - Intergenic
1016485254 6:144530313-144530335 ACTGGTGTCCTTATAATAGGTGG - Intronic
1016582206 6:145641312-145641334 ACTAGTGTCCTTATAAGAGGGGG + Intronic
1016618033 6:146075869-146075891 ACTGCTGTCCTTATAAAAAGAGG - Intronic
1016787757 6:148031639-148031661 ACTAATGTCTTTATAAAAGAGGG - Intergenic
1016799373 6:148153308-148153330 GCTGGTGTCATTATAAAAAGGGG + Intergenic
1017293144 6:152764644-152764666 ACTAATGTCCTTATAAGAAGAGG - Intergenic
1017878525 6:158543677-158543699 ACTGATGTCCTTATAAAAAGGGG - Intronic
1018155151 6:160978726-160978748 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
1018187309 6:161277265-161277287 CCTGGTGTCCTTATAAAAAGAGG + Intergenic
1019826541 7:3289271-3289293 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1020024049 7:4886059-4886081 ACTAGTGTCCTTATAAAAAGAGG - Intergenic
1020854595 7:13402331-13402353 GCTATTCTTCTTATAAAATTGGG - Intergenic
1020896331 7:13944838-13944860 ACTAGTATCCTTATAAAAGGGGG + Intronic
1021905400 7:25328362-25328384 ATTGTTGTCCTTATAAAAGGGGG + Intergenic
1021956901 7:25834240-25834262 ACTGTTATCCTTATAAAAAGAGG + Intergenic
1022284423 7:28941530-28941552 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1022566170 7:31404661-31404683 GCTGGTGTCCTTATAAGAAGAGG + Intergenic
1023166800 7:37350803-37350825 TCTATTATCCTTTTAAGAGGAGG + Intronic
1023664362 7:42506360-42506382 GCCATAGTCTTTATAAGAGGAGG - Intergenic
1024037704 7:45522885-45522907 ACTGGTGTCCTTATAAGAGGTGG - Intergenic
1024347111 7:48324303-48324325 ACTGATGTCCTTATAAAAAGAGG - Intronic
1025306609 7:57867105-57867127 GATTTACTCCTTATAAAAGGAGG - Intergenic
1025482544 7:61000364-61000386 GATTTACTCCTTATAAAAGGAGG + Intergenic
1025562661 7:62388210-62388232 GATTTACTCCTTATAAAAGGAGG + Intergenic
1025877634 7:65500427-65500449 GATTTACTCCTTATAAAAGGAGG - Intergenic
1025953271 7:66162891-66162913 ACTGTTGTCCTTATAAAAAGGGG + Intergenic
1026686110 7:72511668-72511690 GCTGGTGCCCTTATAAAAAGAGG + Intergenic
1027676781 7:81169524-81169546 GCAATTGTCCTTATAAGATATGG - Intergenic
1028124757 7:87100058-87100080 GCCTGTGTCCTTATAAAAAGGGG - Intergenic
1028750583 7:94378029-94378051 GCTATTGTATTTCTAAAATGGGG + Intergenic
1029100774 7:98128311-98128333 ACTGTTGTCCTTGTAAAATGGGG + Intronic
1029157040 7:98524752-98524774 ACTGATGTCCTTATAAAAAGGGG + Intergenic
1029158759 7:98536059-98536081 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
1029569779 7:101361953-101361975 GCTTTTCTGTTTATAAAAGGTGG + Intergenic
1030346946 7:108444693-108444715 ATTAGTGTCCTTATAAAAAGAGG - Intronic
1030736558 7:113055582-113055604 ACTCATGTCCTTATAAAATGGGG + Intergenic
1031029114 7:116715434-116715456 ACTGTTGTCCTTATAAGAAGAGG - Intronic
1031846413 7:126810455-126810477 GCTATTGTCCTGAGACAAGGAGG - Intronic
1034032541 7:147784129-147784151 GCTGCTGTCCTTATAAAAAGGGG - Intronic
1034103246 7:148469173-148469195 ACTGATGTCCTTATTAAAGGGGG - Intergenic
1034445004 7:151109543-151109565 ACTCGTGTCCTTATAAAAGGGGG - Intronic
1035175066 7:157044636-157044658 GCCTGTGTCCTTATGAAAGGGGG - Intergenic
1035333554 7:158111929-158111951 ACTGGTGTCCGTATAAAAGGAGG + Intronic
1035823532 8:2620364-2620386 GCTGTTGTCCTTAAAGAAGATGG + Intergenic
1036000200 8:4594112-4594134 ACCAGTGTCCTTATAAAAAGGGG - Intronic
1036083127 8:5580137-5580159 ACTAGTGTCCTTATAAGAAGAGG + Intergenic
1036475904 8:9093049-9093071 ACTGATGTCCTTATAAAAAGCGG - Intronic
1036515516 8:9440031-9440053 ACTGGTGTCCTTATAAAACGAGG - Intergenic
1036524404 8:9521412-9521434 GCTAATGTCCTTATAAAAAGTGG + Intergenic
1037006199 8:13784060-13784082 TCTAGTGTCCTTTTAAGAGGAGG - Intergenic
1037196757 8:16199988-16200010 ACTAGTGTCCTTATAAGATGAGG - Intronic
1037215588 8:16447380-16447402 ACTCTTGTTCTTATAAAAAGTGG + Intronic
1037307301 8:17518990-17519012 ATTAGTGTCCTTATAAAAAGAGG - Intronic
1037572097 8:20166837-20166859 ACTGTTTTCCTTATAAAAAGAGG + Intronic
1037685592 8:21136962-21136984 ACTGTTGTCCTTATAAGAAGAGG - Intergenic
1038120571 8:24609700-24609722 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1038165525 8:25081774-25081796 ACTTCTGTCCTTATAAAAAGAGG - Intergenic
1038199473 8:25398723-25398745 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1038417661 8:27409080-27409102 ACTGGTGTCCTTAAAAAAGGGGG - Intronic
1038558705 8:28549186-28549208 GCTGGTATCCTTATAAGAGGAGG - Intronic
1038566097 8:28621281-28621303 ACTGGTGTTCTTATAAAAGGGGG + Intronic
1038721832 8:30044037-30044059 GCTGGTGTCCTTATAAGAAGAGG - Intergenic
1039046814 8:33458097-33458119 ACTGGTGTCCTTATAAAAAGGGG + Intronic
1039564850 8:38544032-38544054 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
1039720787 8:40162026-40162048 ACTAATGTCCTTATAAGAAGAGG - Intergenic
1039810975 8:41048059-41048081 GCTGGTGTCCTTATAAAAAGTGG + Intergenic
1040761959 8:50858121-50858143 GCTAGGGTCCTTACAAAAAGAGG - Intergenic
1040871908 8:52108437-52108459 GCTATTGTCCTCATTAGAGAAGG + Intergenic
1040978089 8:53215978-53216000 ACCAGTGTCCTTATAAAAAGAGG - Intergenic
1041350519 8:56943532-56943554 GTTAGTGCCCTTATAAAAAGAGG + Intergenic
1041459988 8:58100672-58100694 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1041741903 8:61165169-61165191 GCTATGCTCCTTATCCAAGGAGG - Intronic
1041884939 8:62797841-62797863 ACTATTGTTATTATAAAAAGGGG + Intronic
1042092946 8:65178820-65178842 ACTGTTGCCCTTATAAAAAGGGG - Intergenic
1042156497 8:65849882-65849904 GATGGTGCCCTTATAAAAGGAGG + Intergenic
1042201036 8:66279481-66279503 ACTAGTGTCCTTATAAAAAAGGG - Intergenic
1042237778 8:66631039-66631061 GCTATTATTATTATAAATGGTGG + Exonic
1042464896 8:69117597-69117619 ACTAATGTCCTTATAAGAAGAGG + Intergenic
1042581508 8:70284306-70284328 CCTATTCTCCCTCTAAAAGGAGG + Intronic
1043295180 8:78653264-78653286 GCTATTATCTTTATTAAAGGTGG - Intergenic
1044534941 8:93347676-93347698 TCTATTGTCGTTATAAAATGTGG + Intergenic
1044706492 8:95013905-95013927 ACTAGTGTCCTTATACAATGGGG + Intronic
1044790706 8:95844127-95844149 ACTAGTGTCCTTACAAAAAGAGG - Intergenic
1045499327 8:102732807-102732829 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1045798279 8:106071550-106071572 GGTATTGCCTTTATAATAGGAGG + Intergenic
1046490742 8:114950622-114950644 ACTGTTGTCCTTATAAGAAGAGG + Intergenic
1046637229 8:116683431-116683453 GCTCATGTCCTTATAAGAAGAGG - Intronic
1047028894 8:120854313-120854335 ACTAGTGTCCTCATAAAAAGGGG + Intergenic
1047227916 8:122972152-122972174 ACTAGTGTCCTTACAGAAGGGGG - Intronic
1047620458 8:126601381-126601403 GATAGTGTCCTTATAAAAACAGG - Intergenic
1047807162 8:128372497-128372519 ACTAATGTCCTTATAAGAAGAGG - Intergenic
1047814316 8:128445919-128445941 ACCGTTGTCCTTATAAAAAGGGG - Intergenic
1047909391 8:129510770-129510792 GATTGTGTCCTTATAAAAAGGGG - Intergenic
1048457538 8:134591666-134591688 ACTGGTGTCCTTATAAAAAGAGG + Intronic
1049517683 8:143070170-143070192 CCTGGTGTCCTTATAAGAGGAGG - Intergenic
1049736347 8:144208487-144208509 GCTGGTACCCTTATAAAAGGGGG - Intronic
1050206611 9:3202988-3203010 ACTAGTGTCCTTATAAGAAGAGG - Intergenic
1050513569 9:6419030-6419052 GCTAGTGTCCTCATAATAAGGGG - Intronic
1051337526 9:16079403-16079425 GCTGGTGTCCTTATAAAGGAGGG + Intergenic
1051871724 9:21745719-21745741 ACTACTGTCCTTATAAAAAAAGG + Intergenic
1052649542 9:31283668-31283690 GACAGTGTCCTTATAAAAAGAGG + Intergenic
1052796862 9:32931125-32931147 ATTAATGTCCTTATAAAAAGAGG - Intergenic
1055105358 9:72506498-72506520 ACTAGTATCCTTATAAAAGGGGG - Intergenic
1055155443 9:73057434-73057456 ACTATTGTTCTTATATAAAGAGG - Intronic
1056192368 9:84196767-84196789 ATTAGTGTCCTTATAAAAAGAGG - Intergenic
1056497745 9:87176858-87176880 ATTAGTGTCCTTATAAAAAGAGG - Intergenic
1058189203 9:101892302-101892324 GCTTTGTTTCTTATAAAAGGTGG - Intergenic
1058529392 9:105890603-105890625 ACTGTTGTCCTTATAAAAAGAGG + Intergenic
1058570085 9:106332198-106332220 ACTGGTGTCCTTATAAGAGGAGG - Intergenic
1059712799 9:116885022-116885044 ACTGTTGTCCTTATAAAAAGGGG - Intronic
1059755000 9:117284405-117284427 TCTGGTGTCCTCATAAAAGGGGG + Intronic
1060001801 9:119965530-119965552 ACTGGTGTCCTTATAAAAAGAGG + Intergenic
1060003169 9:119976855-119976877 ACTAGTGTCCTTATACAAAGAGG - Intergenic
1060255149 9:122020729-122020751 ACTAGTGTCCTTATAAGAGGAGG + Intronic
1060394973 9:123309631-123309653 TCTGGTGTCCTTATAAAAAGGGG + Intergenic
1061277088 9:129575368-129575390 GCTGATGTCCTTATAAGAAGAGG + Intergenic
1062161857 9:135084967-135084989 GCTATAGACCTTACAAGAGGCGG - Intronic
1186065255 X:5756701-5756723 ACTAGAGTCCTTATAAAAGGAGG + Intergenic
1186340145 X:8636297-8636319 GCTAATGACCTTACAAAATGCGG + Intronic
1187088588 X:16068973-16068995 ACTGGTGTCCTTATAAAAAGGGG - Intergenic
1187570706 X:20497952-20497974 GCTCTTGTCAGTAGAAAAGGAGG + Intergenic
1187609129 X:20921194-20921216 CCTATTGTCCTTAGAAAAACAGG + Intergenic
1188204630 X:27339719-27339741 GCTATTCTCCTTATAAACTTGGG - Intergenic
1188312318 X:28632297-28632319 ACTGATGTCCTTATAAGAGGAGG - Intronic
1188396864 X:29695652-29695674 GTTATTCTCCTTTTAAAAAGAGG - Intronic
1188847900 X:35096380-35096402 GATGGTGTCCTTATAAAAAGAGG + Intergenic
1189108762 X:38265074-38265096 ACTGGTGTCCTTATAAAAAGAGG + Intronic
1189211820 X:39290285-39290307 GCTGATGTCCTTATAAGAAGAGG - Intergenic
1189318243 X:40070854-40070876 CCGATTGTCCTTATGAATGGTGG - Intronic
1189681868 X:43525506-43525528 ACTGTTGTCCTTATAAGAAGAGG + Intergenic
1189714733 X:43853651-43853673 ACTGGTGTCCTTGTAAAAGGAGG + Intronic
1189950514 X:46225612-46225634 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1189961567 X:46329444-46329466 ACTAGTGTCCTTATAAAAAGGGG + Intergenic
1190146403 X:47895268-47895290 ACTGATGTCCTTATAAAAAGGGG + Intronic
1191678642 X:63817938-63817960 ACTGGTGTCCTTATAAAAAGGGG + Intergenic
1193298424 X:79859378-79859400 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1193368485 X:80663564-80663586 ACTAGTGTCTTTATAAGAGGAGG + Intergenic
1193432184 X:81421554-81421576 GTTTTTCTCCTAATAAAAGGAGG + Intergenic
1194458316 X:94132484-94132506 GCTGGTGTCCTTATAAGAAGAGG + Intergenic
1194794544 X:98194966-98194988 ACTGATGTCCTTATAAAAAGAGG - Intergenic
1195209551 X:102640056-102640078 ATTAGTGTCCTTATAAAAAGGGG + Intergenic
1195525316 X:105882258-105882280 GCTATTGCTCTTACAAAAAGCGG - Intronic
1195907521 X:109859923-109859945 ACTGCTGTCCTTATAAGAGGAGG + Intergenic
1197015137 X:121615656-121615678 GGTATTGTCATTATAATAGGTGG + Intergenic
1197190531 X:123642581-123642603 GCTATTGATAATATAAAAGGTGG + Intronic
1198436767 X:136624758-136624780 ACTGCTGTCCTTATAAAAAGGGG + Intergenic
1198569875 X:137943242-137943264 GCTATTTTCATTATAAAGAGAGG - Intergenic
1199407389 X:147478512-147478534 ACTGGTGTCCTTATAAAAAGAGG - Intergenic
1199506730 X:148570916-148570938 ACTAGTATCCTTATAAAAAGGGG - Intronic
1199532889 X:148869896-148869918 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1199801912 X:151260117-151260139 CCTAGTGTCCTTATAAAAGAGGG - Intergenic
1199822165 X:151460473-151460495 ACTGTTGTCCTTATAAAACAGGG + Intergenic
1199903847 X:152205040-152205062 ACTGGTGTCCTTATAAAAAGGGG - Intronic
1200298714 X:154950072-154950094 ACTAGTGTCCTTATAAGAAGAGG - Intronic
1200822128 Y:7597348-7597370 ACTGGTGTCCTTATAAAAGGAGG + Intergenic
1201056544 Y:9998268-9998290 GCTGGTGGCCTTATAAGAGGAGG - Intergenic
1201483638 Y:14468798-14468820 ACCAGTGTCCTTATAAAAAGGGG + Intergenic
1202238173 Y:22736669-22736691 ACTGGTGTCCTTATAAAAGGAGG - Intergenic