ID: 966387912

View in Genome Browser
Species Human (GRCh38)
Location 3:179421202-179421224
Sequence CTGTGAGAGAAAAAGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 1, 2: 2, 3: 48, 4: 560}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966387912_966387916 14 Left 966387912 3:179421202-179421224 CCTAATTCCTTTTTCTCTCACAG 0: 1
1: 1
2: 2
3: 48
4: 560
Right 966387916 3:179421239-179421261 TAATTTACTTTCTTTCTCTATGG 0: 1
1: 27
2: 217
3: 738
4: 1804

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966387912 Original CRISPR CTGTGAGAGAAAAAGGAATT AGG (reversed) Intronic
900526143 1:3129741-3129763 CTGGAAGAGAAAAGAGAATTGGG + Intronic
903224323 1:21886271-21886293 TTGGGAGAGATAAAGTAATTGGG - Intronic
903783676 1:25841210-25841232 CTGTGTGAGAAAAGGTTATTTGG + Intronic
904406659 1:30294982-30295004 CTGTAACAGAAAAAGGAAATAGG + Intergenic
906048114 1:42848108-42848130 ATGTAAGAGCAAAAGGATTTAGG - Intronic
906230257 1:44156572-44156594 AGCTCAGAGAAAAAGGAATTGGG + Intergenic
906270770 1:44476554-44476576 CTGTGAGAGAAAGAGGGCCTGGG - Intronic
907653634 1:56320554-56320576 CTGAGGGAGAAAAAGGAGTGGGG - Intergenic
908313333 1:62907542-62907564 TTATGAGAGAAAAAGGAAAGGGG + Intergenic
908800730 1:67877628-67877650 CTTTGAGAGAAAAAATAAATCGG + Intergenic
908823565 1:68112898-68112920 CTGTTAAAGAGCAAGGAATTTGG + Intronic
908986119 1:70023907-70023929 CTGTAAGAGAAGATTGAATTGGG + Intronic
909311785 1:74159891-74159913 GTGCGAGAGAAAGAGGAATATGG - Intronic
909464241 1:75955029-75955051 ATGTGAGAGAAAACTGGATTTGG + Intergenic
910035009 1:82778694-82778716 CAGTGAAAGAAAAAGCAATTCGG - Intergenic
910157660 1:84238092-84238114 CGGTGAGTGAGAAAGGAATTAGG - Exonic
911273669 1:95834350-95834372 ATATGATAGAAAAAGGAAATGGG + Intergenic
911383529 1:97145970-97145992 CTGGGAGAGAAAAGGGAAAAAGG + Intronic
912074503 1:105855633-105855655 CTGTGAAAGAAAAATAAATCTGG + Intergenic
912191108 1:107341744-107341766 CTATGAGAGAAAAAGAGTTTGGG + Intronic
913210205 1:116576043-116576065 CAGGGAGAGAAAAATGAATAAGG + Exonic
913231099 1:116741354-116741376 CTGGAAGTGAGAAAGGAATTGGG + Intergenic
914871030 1:151473823-151473845 TTGAGAGAGAAAAAGAAAGTAGG - Intergenic
914962862 1:152221644-152221666 CAGAAAGAGAAAAAGGAATATGG + Intronic
915042130 1:152977447-152977469 CTATGAAAGAAAAAGGGTTTGGG - Intergenic
915270181 1:154748112-154748134 CTGTGAATGAACAAGGACTTAGG + Intronic
915484845 1:156213051-156213073 CTGTGAGGAAAAAAGGCATGAGG + Exonic
915529802 1:156496847-156496869 CTGTGGGAGAAATAGCCATTAGG - Intronic
915596507 1:156899470-156899492 CTGACAGAGAGAAAGGAAGTGGG - Intronic
915743120 1:158134896-158134918 CTGAGATAGAAAAAGGAAAGAGG - Intergenic
917039288 1:170786069-170786091 ATATGAGAGAAAAATAAATTTGG + Intergenic
917158872 1:172034969-172034991 CCGTGAGTGAAAAAAGAATGTGG + Intronic
917509132 1:175655787-175655809 CTGTGAGGGAGAAAGGAACAGGG + Intronic
917871182 1:179243434-179243456 TTGTGAGAAAAATATGAATTTGG + Intergenic
918322775 1:183380797-183380819 ATGTGAGAGGAAAAGAAATACGG + Intronic
918556182 1:185802039-185802061 CTGAGAGATAAAAAGGACTAAGG + Intronic
919400660 1:197112480-197112502 CTGTGACAGAAAAATATATTGGG + Intronic
919555525 1:199047518-199047540 CTGAGAGAGAATAAGCAATTTGG + Intergenic
920650890 1:207836592-207836614 ATGAGAGAGAAAAAGGAGATGGG - Intergenic
921398168 1:214691084-214691106 CTCTGAGACAATAAGTAATTAGG - Intergenic
921722288 1:218486550-218486572 CTGAAAGAGAAAATGAAATTTGG - Intergenic
921796082 1:219346311-219346333 CAGTTAGGGAAACAGGAATTAGG + Intergenic
921812545 1:219531032-219531054 CTGGGAGATAAAAACGAATGAGG + Intergenic
921878959 1:220231836-220231858 CTGTGAATGAAACAGGCATTAGG + Intronic
923721762 1:236473124-236473146 CTCTAAGAGGAAAAGGACTTTGG - Intronic
924387781 1:243515403-243515425 CTCTGAGTGAATTAGGAATTGGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063152460 10:3349611-3349633 CTGGAAGAAAAAAAGGAATGCGG + Intergenic
1063212090 10:3890077-3890099 CTGTGACAAAAAAAGGATTGAGG - Intergenic
1063455067 10:6177283-6177305 GTGTAAGAGAAAAAGCAATCTGG - Intronic
1063732886 10:8719827-8719849 CTGTGGAAGAAAAAGACATTAGG - Intergenic
1063759093 10:9051871-9051893 CTGTGAGAGAGAAAGCCATGGGG - Intergenic
1063825300 10:9890724-9890746 CTGTGAGAGAAAAAGGAGAGAGG - Intergenic
1063938382 10:11102809-11102831 ATGAGAGAGAAAAAGGAGTGAGG - Intronic
1063953618 10:11246568-11246590 CTGTGAGAGGCCAAAGAATTTGG - Intronic
1064382419 10:14858279-14858301 CTGTGAGAGATAATGAAATGAGG - Intronic
1064817888 10:19287374-19287396 GAGGGAGAGAAATAGGAATTTGG - Intronic
1065220755 10:23493603-23493625 CTCTGAAAGAAAAAAGGATTGGG - Intergenic
1065736021 10:28753194-28753216 ATGTGAGAGAAAGAGAAATTGGG + Intergenic
1065813167 10:29461007-29461029 ATGTGTGGGAAACAGGAATTAGG - Intronic
1066223247 10:33356555-33356577 CTATGTAAGAAAAAGGAATTAGG - Intergenic
1066652546 10:37671520-37671542 CTCTGAGTGAAAAAGTAATTCGG + Intergenic
1067519109 10:46981748-46981770 CTTTGAGAGGATAAGGAATATGG - Intronic
1067643136 10:48070086-48070108 CTTTGAGAGGATAAGGAATATGG + Intergenic
1067912494 10:50360673-50360695 ATGTGAGAGCTAATGGAATTTGG - Intronic
1067987641 10:51167707-51167729 GTGTGAGAGAAAGATAAATTAGG + Intronic
1068786046 10:60975281-60975303 TGGTGAGAGAAAAATGCATTAGG - Intronic
1069009149 10:63351737-63351759 CTGTGAAGGTAAAAAGAATTAGG - Intronic
1069119742 10:64555295-64555317 CTGTGAAAGAGAAAGAAATTGGG - Intergenic
1069529711 10:69207770-69207792 CTGAGAGAGAAAGAGGAAAAGGG - Intronic
1070063707 10:73012543-73012565 TTGTGAGAGAAATACAAATTGGG + Intronic
1071867068 10:89746441-89746463 CTGTGAGATGACACGGAATTTGG - Intronic
1072002095 10:91206442-91206464 GTGGGAGGGAGAAAGGAATTAGG + Intronic
1072302918 10:94079137-94079159 CCTTGAGAGAAAAAGCAACTTGG - Intronic
1075470393 10:122684513-122684535 AGGTCAGAGAGAAAGGAATTTGG - Intergenic
1076032220 10:127169309-127169331 ATGTGAGAGTCAAAGGAATTCGG - Intronic
1076281874 10:129253165-129253187 ATGTGAAAGAAAATGGAATATGG + Intergenic
1076623120 10:131805773-131805795 CTGTGTGAGAAAACTAAATTAGG - Intergenic
1080153747 11:29083586-29083608 TTGTGACAGAAAAAGTAATGGGG + Intergenic
1080566782 11:33516959-33516981 CTTTGAGAGTAATAGCAATTAGG - Intergenic
1081299927 11:41438493-41438515 CTGAAAGAGTAAAAGGAAATTGG + Intronic
1081327261 11:41759959-41759981 TTGAAAGAGAAAAAGAAATTTGG + Intergenic
1081343244 11:41952977-41952999 CTCAGAGGGAAAAAGGAATGAGG + Intergenic
1081458985 11:43253486-43253508 ATGTGAGAGACAAGGGAACTAGG - Intergenic
1082185812 11:49179904-49179926 CTGTGGTAGAAGTAGGAATTAGG - Intronic
1083383108 11:62284052-62284074 ATGTGAGAGGAAAATAAATTTGG + Intergenic
1084576788 11:69993803-69993825 CTGGGGGAGAAAAAGGAATCTGG - Intergenic
1084656996 11:70525519-70525541 AGGTGAGAGAAAAGGGCATTTGG + Intronic
1085764756 11:79273118-79273140 CTCTGAGAGGTAAAGGAACTTGG - Intronic
1085845424 11:80059401-80059423 CTCTGGCAGAAAATGGAATTCGG + Intergenic
1086680514 11:89665470-89665492 CTGTGGTAGAAGTAGGAATTAGG + Intergenic
1086815597 11:91366776-91366798 CAGTGACAGAGAAAGGAATGTGG - Intergenic
1086990309 11:93295734-93295756 TTGTGGGAGAAAGAGGAATGTGG - Intergenic
1087111778 11:94477754-94477776 GTCTGAGAGAAAAAGCAATGCGG + Intronic
1087920229 11:103858513-103858535 CTGTGACTGAAATGGGAATTAGG + Intergenic
1088049652 11:105496816-105496838 CTGGAACAGAAAAAGGATTTAGG - Intergenic
1088192344 11:107239934-107239956 CAGTGAGAGAGAAAGAGATTTGG - Intergenic
1089766228 11:120767988-120768010 CTGAGAAAGAAAAAGAAAGTTGG - Intronic
1090014080 11:123069720-123069742 TTGTGAGAGAAAAAAGTAATTGG + Intergenic
1090142427 11:124278691-124278713 CTGAGAGAGAATAAGGAACTTGG + Intergenic
1090524868 11:127522281-127522303 CTGTGTGGGAGAAAGGAAATTGG + Intergenic
1090562975 11:127953058-127953080 CTGTGAAAAAAAAATAAATTAGG - Intergenic
1090880320 11:130826994-130827016 AAGTTATAGAAAAAGGAATTTGG + Intergenic
1090979684 11:131708450-131708472 ATGTAAGACAAAAAGCAATTTGG + Intronic
1091174245 11:133545602-133545624 CTTTGGGAGAACAAGGCATTCGG + Intergenic
1091358135 11:134953914-134953936 TGGTGAGAGAAGGAGGAATTTGG - Intergenic
1091388407 12:109873-109895 GTGTGAGGGAAAAAGGAAACAGG - Intronic
1091524992 12:1290856-1290878 CTGTGACAGAAAGAAGAATCTGG - Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1091896800 12:4111482-4111504 AACTGAGAGAAAAAGGAAGTTGG - Intergenic
1092095247 12:5836846-5836868 GTGTTATAAAAAAAGGAATTAGG - Intronic
1092596209 12:10007606-10007628 CTGAGAAAGAAAAAGAGATTGGG + Intronic
1092784922 12:12018095-12018117 GTAAGAGAGAAAAAGGGATTGGG + Intergenic
1093448157 12:19283821-19283843 ATGTGAGAGACAAAAGAATGGGG + Intronic
1094308251 12:29046353-29046375 CTGAGAAAGAAAAACGAAGTTGG + Intergenic
1094782679 12:33810575-33810597 CTGAGAAGGAAAAAGGAATAGGG + Intergenic
1095184427 12:39185312-39185334 CTGTTAGAGATAAAGTCATTTGG + Intergenic
1095295433 12:40521954-40521976 CTGTGAGTGAAAAAGCAATGTGG - Intronic
1095418138 12:41998184-41998206 CTGAGAAAGAAGGAGGAATTTGG - Intergenic
1096770604 12:53933805-53933827 CTGTGAAAGAAAGAGGACTGGGG + Intergenic
1096850195 12:54430591-54430613 CTGAGAGAGAGAAAGGAAGAAGG + Intergenic
1096865095 12:54557928-54557950 CCTTGAGAGAGAGAGGAATTGGG - Intronic
1097421276 12:59382817-59382839 GAGTGAGTGAAAAAAGAATTAGG - Intergenic
1097950912 12:65427466-65427488 CAGTGAAAGAAAAAGAAATCAGG - Intronic
1099468489 12:83017276-83017298 GTGAGAGAGAAACAGGAATTAGG + Intronic
1099751359 12:86777986-86778008 CTTCTAGAGAAAAAGGAATAAGG - Intronic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1100052800 12:90470957-90470979 CAGTGGGAGAAAAAGAGATTAGG - Intergenic
1100152256 12:91752898-91752920 ATGTGAACGAAAGAGGAATTGGG - Intergenic
1100262359 12:92944769-92944791 CTGTGAGGTAAAAAGTAATGAGG + Intergenic
1100666875 12:96764325-96764347 CTGTAAAAGAGAAAGGAGTTGGG + Intronic
1100932580 12:99626986-99627008 TTGTGAGAGAAAAGGGAAAGTGG - Intronic
1100939766 12:99713396-99713418 CTGTTAAACAAAAAGGAACTAGG - Intronic
1101492742 12:105224329-105224351 CTGGGATACAAAAAGGAACTGGG + Intronic
1101573468 12:105976456-105976478 CTGTTAGAGAAAGAGCTATTAGG + Intergenic
1101656723 12:106728212-106728234 CTGTTATGGAAAAAGGCATTAGG - Intronic
1101787703 12:107899982-107900004 CTGCTAGAGAAAAACGAATGGGG - Intergenic
1102106538 12:110328959-110328981 ATGTGATAGAAAAACCAATTAGG - Intronic
1102397575 12:112600387-112600409 TTATGACAGAAAAAGGACTTAGG - Intronic
1102630321 12:114272738-114272760 CTGAGAGAATAAAAGGAATTTGG - Intergenic
1103705853 12:122871877-122871899 CAGTGAGTGAAAAGGGAACTAGG - Intronic
1103895393 12:124269766-124269788 CATTGACAGATAAAGGAATTTGG + Intronic
1104153328 12:126106245-126106267 CTGTGGGAGAAAGAGAAATAAGG - Intergenic
1104189456 12:126465362-126465384 CTTGCAGAGAAAAAGAAATTAGG + Intergenic
1104647939 12:130510218-130510240 CTGTGGGACAAATAGGATTTAGG - Intronic
1104668885 12:130667096-130667118 ATGGGAGAAAAAAAGGAATGAGG + Intronic
1105298803 13:19115212-19115234 TTGCAAGAGAAAAAGGAAGTGGG - Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1106592971 13:31113426-31113448 CCGTGAGAGAAATCAGAATTTGG + Intergenic
1106656245 13:31750179-31750201 ATGTGTGAGAAAACGGAAATGGG - Intronic
1106976310 13:35220900-35220922 CTGAGAGAGAAATAGGCATAGGG - Intronic
1107268863 13:38590789-38590811 ATGTCAGAGAAACAGTAATTAGG - Intergenic
1107580440 13:41778054-41778076 ATGCTAGAGAAAAAGGAACTAGG + Exonic
1107874995 13:44782661-44782683 CTATGAGAAAAAAATGAGTTAGG - Intergenic
1108382885 13:49871173-49871195 GTGTGTGAGAAAAAGGGATAAGG - Intergenic
1109105991 13:58251960-58251982 GGGTGAGAGAGAAAGGAATAAGG - Intergenic
1109482789 13:62978034-62978056 CTGAGAGAGAAAAAATAATCTGG - Intergenic
1109813488 13:67547115-67547137 CTCAGAGAGAAAAAGAACTTTGG + Intergenic
1110184866 13:72661566-72661588 CTGTGACATTAAAAGGAATCAGG + Intergenic
1110948747 13:81458154-81458176 CTTTGAGAGGAAAAGAAATTAGG + Intergenic
1111919707 13:94397210-94397232 CAGTGAGAGAAATGGGAAATGGG + Intronic
1112048230 13:95618616-95618638 CGGGGAGAGAAAAAGAAACTGGG - Intronic
1112234126 13:97620078-97620100 TAGTGAGTGAAAAAGGTATTTGG - Intergenic
1112646029 13:101332765-101332787 ATGTGAGAAATAAAGGAAATAGG + Intronic
1112808492 13:103189082-103189104 CTGGGAGAGAGAAATGAATTTGG + Intergenic
1113391037 13:109897464-109897486 CTGTGAGAGAAAAAGCCTTAAGG - Intergenic
1114010290 14:18359065-18359087 CTGTAAGAGAAGTAAGAATTGGG - Intergenic
1114349368 14:21834029-21834051 CTCTGAGACAAAGAGCAATTTGG - Intergenic
1114818483 14:25987701-25987723 CTGTGAGTGAAAAAACAACTAGG + Intergenic
1115029711 14:28780646-28780668 CTGTGAAATAAATAGGACTTGGG - Intronic
1115541238 14:34423506-34423528 CTGTGTGAGACAAATGGATTTGG - Intronic
1115762829 14:36592324-36592346 CTGTAAGAGCTAAAGGAACTTGG - Intergenic
1116131915 14:40865370-40865392 GTCTGAGAGAAAAAGCAATAGGG - Intergenic
1116862238 14:50003783-50003805 CTGAGAGAGAAAGAGGAAGCGGG - Intronic
1117138251 14:52759952-52759974 CTTTGGGAGAACAAGGCATTTGG + Intronic
1117194720 14:53328359-53328381 TTCTGAGAGGAAAAGGAATCAGG + Intergenic
1117265778 14:54085354-54085376 CTGTAAGCAAGAAAGGAATTTGG + Intergenic
1117419940 14:55534326-55534348 CTGGGACAGAAATAGAAATTTGG + Intergenic
1117881395 14:60316591-60316613 CTCTGAGAGAGAAAGGAACATGG + Intergenic
1118102764 14:62624994-62625016 CTGTGAGAGAAAAAAGGAAGAGG - Intergenic
1118342598 14:64907546-64907568 CTCTGAGAGGTAAAGGAGTTTGG - Intergenic
1119426373 14:74537590-74537612 GACTGGGAGAAAAAGGAATTGGG - Intronic
1119455703 14:74753790-74753812 CAGGGACATAAAAAGGAATTTGG - Intergenic
1119520936 14:75284612-75284634 CTGAGTGAGTAAAAGGGATTTGG - Intergenic
1119811111 14:77520292-77520314 CTGAGAGAAAAAGAAGAATTTGG - Intronic
1120019973 14:79517859-79517881 CTCTGAAAGAAAAAGTAATAAGG - Intronic
1120091762 14:80340548-80340570 CTATGAGAAAAGAAAGAATTGGG - Intronic
1120524164 14:85558377-85558399 GTGGGAGAGAAGGAGGAATTTGG + Intronic
1120603325 14:86539971-86539993 ATGTGACAGTAATAGGAATTTGG - Intergenic
1121361048 14:93260285-93260307 AGGTGACAGAAAAAGGAAATTGG + Intronic
1123786134 15:23675618-23675640 CTGAAAGAGAAAAAGGATGTAGG + Intergenic
1124103449 15:26716699-26716721 CTGTGAAAGAGAAAGGCAGTTGG - Intronic
1124832179 15:33159912-33159934 GAGTGAGAGAAAAAGAAATAGGG - Intronic
1125544678 15:40494395-40494417 CTGTAAGAGAAAGAGGACTGGGG - Intergenic
1126058513 15:44755799-44755821 CTATTAGAGAAAAATGAAATAGG + Intronic
1126123328 15:45272798-45272820 GTGTGTGAGAGAAAGGAATGGGG - Intronic
1126758598 15:51948550-51948572 CAGTCAGAGAAAAATAAATTTGG + Intronic
1126768354 15:52031329-52031351 CAGTGAGAGATAATGGAATTTGG + Intronic
1127653022 15:61027796-61027818 CTTTGAGAGAAAATGTAATTTGG - Intronic
1128595260 15:68940248-68940270 AAGTGAGAGGAAAAGGAATGTGG - Intronic
1130006140 15:80100466-80100488 CAGAGAGATAAAAAGAAATTTGG - Intronic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1134621237 16:15691121-15691143 CTGTGCCAGAAAAAGGATTCAGG - Intronic
1135719059 16:24799238-24799260 CTGTGAAAAAAAATGGACTTAGG - Intronic
1136670221 16:31849840-31849862 GTGTGAGAGAAAGAGGAAACAGG + Intergenic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1138484107 16:57325052-57325074 ATGTGAGAGAAAAGGGAAGGAGG + Intergenic
1139200906 16:64976078-64976100 CAGTGAAAGAAAAAGCAAATGGG + Intronic
1139304787 16:65975820-65975842 ATTTGATAGAAGAAGGAATTAGG + Intergenic
1140995293 16:80253075-80253097 AAGTGAGAGTCAAAGGAATTAGG - Intergenic
1141239198 16:82249391-82249413 CTGTGAGAGAAAAATGTAGACGG + Intergenic
1142897478 17:2991274-2991296 CTGAAAGAGAAACAGGAATAAGG - Intronic
1143184260 17:5000879-5000901 CAGTGAGAGACAGAGGATTTAGG + Intronic
1144262069 17:13531428-13531450 CTGAGTGAGAAAAACGAAATAGG + Intronic
1145227367 17:21141356-21141378 ATTTGAGAGAAAAAGCAATAGGG + Intronic
1145415638 17:22711724-22711746 ATGAGAGAGGAGAAGGAATTGGG + Intergenic
1145715466 17:27015628-27015650 CTGTGAGAAAAAAAGATACTTGG - Intergenic
1147111137 17:38262606-38262628 CTGAGAGTAATAAAGGAATTAGG - Intergenic
1147180728 17:38683908-38683930 CTTTGAGAGACAAAGGAAAGAGG + Intergenic
1148418376 17:47525838-47525860 CTGAGAGTAATAAAGGAATTAGG + Intronic
1149130878 17:53300739-53300761 CTGAAAAAGAAAAATGAATTTGG + Intergenic
1149310719 17:55390606-55390628 TTTTGAGAGAAAAAAGTATTTGG - Intergenic
1150306405 17:64089016-64089038 CTCTGAGAAAAAGAGGAATGTGG + Intronic
1151554800 17:74841377-74841399 GTGTGATAGAAAAAGGAAGTGGG + Intergenic
1153026005 18:673075-673097 CTCTAAAAGAAAAAGGAACTAGG + Exonic
1153335416 18:3918989-3919011 AAGTGACAGAAAAAAGAATTTGG + Intronic
1153580071 18:6563874-6563896 GTGTGTTAGAAAAAGCAATTCGG - Intronic
1154156245 18:11946585-11946607 CAGTGAGAGAACAAAGAATCGGG - Intergenic
1154248997 18:12727041-12727063 CTGGGAGAGAAAATGCAAGTTGG - Intergenic
1155212899 18:23618680-23618702 AAATGGGAGAAAAAGGAATTTGG - Intronic
1155408434 18:25515298-25515320 CTGGGGGAAAAAAAGGATTTTGG - Intergenic
1155422310 18:25668448-25668470 CTATGAGAGAAAAAGGAAAGGGG + Intergenic
1155514355 18:26609339-26609361 CTGTGATATTAAAATGAATTCGG + Intronic
1155583956 18:27343569-27343591 CCATGAGAGGAAAAGGATTTGGG - Intergenic
1155744738 18:29340166-29340188 TTGTGGGAAAAAAAGGACTTGGG - Intergenic
1156018030 18:32568178-32568200 GTGTGAGAGTTTAAGGAATTTGG + Intergenic
1156634414 18:39010441-39010463 CTGAGGAAGAGAAAGGAATTTGG - Intergenic
1156830982 18:41490859-41490881 CTGTGAGAAAACAAAGAAATCGG + Intergenic
1158044756 18:53142865-53142887 CTGTTACAGAAAAAGGAGTCTGG - Intronic
1158233090 18:55280554-55280576 CTTTGAGAGCAAAAGAAAATGGG - Intronic
1158371541 18:56811941-56811963 ATATGAAAGACAAAGGAATTAGG - Intronic
1158902138 18:61973841-61973863 GTGTGAGAGAAACAGAAGTTTGG + Intergenic
1160196377 18:76758881-76758903 ATGAGAGAGAGAAAGGAAGTGGG + Intergenic
1161235272 19:3194712-3194734 CTGTTAGAGAAGAAGGAAAGAGG + Intronic
1161901061 19:7119989-7120011 CTGTGAAAGGAAAATCAATTTGG + Intronic
1161906854 19:7163200-7163222 CTGTCAGGGAGAAAGGAAATGGG + Intronic
1162242762 19:9369716-9369738 CTAGAAGAGAAAATGGAATTAGG - Intronic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1165290791 19:34883748-34883770 CTGTCAGAGAGAAAGGCATTGGG - Intergenic
1165713596 19:38029403-38029425 TTGTGTGAGAAAAAGGAACCAGG + Intronic
1166205649 19:41267007-41267029 CTCTGAGAGGAAAGCGAATTAGG + Intronic
1167117770 19:47498076-47498098 CTGCGAGAGGGAGAGGAATTCGG + Intronic
1168199796 19:54806222-54806244 CTGTGACAGAAACAGGCAGTGGG - Exonic
1168364082 19:55769934-55769956 CTGTGAGAGAAAAATAGATGAGG - Intronic
925305617 2:2846379-2846401 CTGTGAGGGAAAAAGGGCTCAGG - Intergenic
925454385 2:4002855-4002877 CTGCAAGAGAAAAAGGAACAGGG - Intergenic
925537922 2:4936149-4936171 CTGTAAGAGAACGAGGTATTTGG + Intergenic
926100096 2:10110051-10110073 CTGAGAGGGAAAAAGAAACTTGG - Intergenic
927116882 2:19913246-19913268 CTGTGAGAAAAAAATTTATTTGG + Exonic
927981123 2:27375823-27375845 CTGGGAGAGGAAGGGGAATTCGG - Intronic
928086917 2:28351674-28351696 GTGAGAGAAAAAAAGGACTTAGG - Intergenic
928538741 2:32264489-32264511 CTGTGAGATGGAAAGGACTTTGG - Intronic
928865565 2:35913662-35913684 CTATCAGAGAAAATGGGATTTGG - Intergenic
929149625 2:38735932-38735954 CTATGACAGTTAAAGGAATTTGG - Intronic
929162168 2:38843211-38843233 CTGAGAAAGACAAAGGAATGTGG + Intronic
929810891 2:45188524-45188546 CTCTGAGAGAGAAATGGATTTGG - Intergenic
929955370 2:46454190-46454212 CTAAGAGAGAAAAGGGAAATTGG - Intronic
930293843 2:49529508-49529530 CTGTGAGAAAAACAAGATTTGGG - Intergenic
930325986 2:49918466-49918488 ATGTGAGAGTCAAAGAAATTAGG + Intergenic
930380941 2:50627501-50627523 CTATAAGAGAAAAATGAAATTGG + Intronic
930799080 2:55423747-55423769 CAGGGAGAGAAAGAGAAATTAGG + Intergenic
930975570 2:57455363-57455385 AGGGAAGAGAAAAAGGAATTTGG + Intergenic
931021020 2:58045680-58045702 CTTTGATAGAATAAGGAATTGGG - Intronic
931111122 2:59112806-59112828 GTGAGAGAGAAAAGGGAATCAGG - Intergenic
931212663 2:60212673-60212695 TTGTGAGAGTGAAAGGGATTTGG - Intergenic
931243973 2:60477701-60477723 CTGTGAGAGACAAGGGAGTGGGG + Intronic
931530265 2:63206366-63206388 CTGGGAGAGAAAAAGGATAAAGG - Intronic
931983988 2:67723877-67723899 CTGTGAGTGAACATGGCATTAGG - Intergenic
932781598 2:74561954-74561976 CTGGGAGAGAAAAGGGATATTGG - Intronic
933356495 2:81216534-81216556 CTGTGATAGAAAACAGAATTTGG - Intergenic
934130802 2:88947114-88947136 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934132813 2:88966075-88966097 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934135441 2:88992222-88992244 CTTACAAAGAAAAAGGAATTGGG + Intergenic
934137375 2:89009795-89009817 CTGAGAAAGAAAAAGAAATTGGG + Intergenic
934140235 2:89040037-89040059 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934146463 2:89099672-89099694 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934148198 2:89117155-89117177 CTGAGAAAGAGAAAAGAATTAGG + Intergenic
934156166 2:89203095-89203117 CTCTTAGAGAAGAAGGAAATTGG - Intergenic
934157330 2:89215706-89215728 GGGTAAGAGAAAAAGGTATTAGG + Intergenic
934211151 2:89979668-89979690 CTCTTAGAGAAGAAGGAAATTGG + Intergenic
934221089 2:90083456-90083478 CTGAGAAAGAGAAAAGAATTAGG - Intergenic
934222804 2:90100903-90100925 CTGAGAAAGAGAAAAGAATTAGG - Intergenic
934228999 2:90160500-90160522 CTGAGAAAGAGAAAAGAATTAGG - Intergenic
934233729 2:90210694-90210716 CTAAGAAAGAAAAAGAAATTGGG - Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
935584998 2:104792644-104792666 ATGTGAAAGAAAAATCAATTCGG - Intergenic
936415185 2:112301291-112301313 CTCTGTCATAAAAAGGAATTTGG - Intronic
936572149 2:113626278-113626300 CTGTGAAAGGAAAATGAATCTGG + Intergenic
938186187 2:129234085-129234107 CTGTGAGAAAAAAGGCAAGTGGG + Intergenic
938286817 2:130125936-130125958 TTGCAAGAGAAAAAGGAAGTCGG - Intronic
938295122 2:130173137-130173159 GTGTGAGAGGCAAAGGAAATGGG - Intronic
938428780 2:131212927-131212949 TTGCAAGAGAAAAAGGAAGTCGG + Intronic
938461504 2:131500701-131500723 GTGTGAGAGGCAAAGGAAATGGG + Intergenic
939125643 2:138174359-138174381 CTGGGTTAGAAAAAAGAATTGGG - Intergenic
939201031 2:139034673-139034695 CTCTAAGAGTAAAAGCAATTTGG - Intergenic
939363064 2:141198661-141198683 CTGTGCTAGAAGAAGGAATTGGG - Intronic
939638741 2:144613807-144613829 CTGTGAGAGAATATGGCATATGG + Intergenic
939881785 2:147639643-147639665 CTCTGACAGAGAAAGGGATTTGG + Intergenic
939885408 2:147676093-147676115 CTGTGAGAGTCAAAGGAAGCTGG - Intergenic
940075289 2:149734728-149734750 TTGTGAGAGACACAGGAAATTGG - Intergenic
940081573 2:149809038-149809060 CTGAGAGTGAAAAAGGAAAATGG - Intergenic
940841070 2:158582576-158582598 CTGTAAGAGAAAAACAAACTAGG + Intronic
941179617 2:162243067-162243089 GGGCGAGAGAAAAAGGATTTAGG - Intronic
941368359 2:164634215-164634237 CTTTGTGAGAAGAAGAAATTTGG + Intergenic
941460213 2:165761793-165761815 CTGTTAAAGAAAATGCAATTAGG + Intronic
941925045 2:170885963-170885985 CTGAGAGTGAAAAAAGAATGTGG - Intergenic
942329432 2:174806426-174806448 CTGAGAGAGAAAAAAAATTTTGG + Intronic
942612654 2:177757915-177757937 CATTGAGACTAAAAGGAATTAGG - Intronic
943688292 2:190842591-190842613 CTGTGAGAGAAAAATAAGGTAGG - Intergenic
945570627 2:211463163-211463185 CTGTGACTGAAAAAGAAGTTAGG + Intronic
945744988 2:213709412-213709434 TTATGAAAGAAAAAAGAATTAGG + Intronic
946112016 2:217428189-217428211 CAGAGAGAGAAAAAAGAAATGGG + Intronic
946116922 2:217471098-217471120 CTGTGAAAGACAAAGAAAATTGG - Intronic
947166964 2:227272509-227272531 TTATGAGAGAAAATGGAAGTGGG + Intronic
947313533 2:228829940-228829962 CTCTGATAAAAAAAGGAAATGGG + Intergenic
947334662 2:229068940-229068962 CTGAGAGAGAGAGAGGGATTGGG - Intronic
947783634 2:232794046-232794068 CAGTGAGAGGAGCAGGAATTTGG + Intronic
947936290 2:234007182-234007204 CTGGGAGAGAGAGAGGTATTTGG + Intronic
1169003336 20:2184556-2184578 CTGTGAGAGCCAAAGGAAATGGG - Intergenic
1169381834 20:5113802-5113824 CTGTGAGTGGAGAAGGAAATAGG - Intergenic
1170756022 20:19207909-19207931 CATTTAGAGAAAAAGGAAATGGG + Intergenic
1171983911 20:31646069-31646091 CTGTGAGAGATAAAGGAGAGAGG + Intergenic
1172184274 20:33021554-33021576 CTCAGAGAGAAAAAGGAACTTGG - Intronic
1172763560 20:37338529-37338551 CTGGGACAGAAAAAGGACATAGG - Intergenic
1173104008 20:40114833-40114855 CTCTGAGAGAAGATGGAGTTTGG + Intergenic
1173322195 20:41998184-41998206 CTGGAAGCGAGAAAGGAATTGGG + Intergenic
1173426410 20:42947210-42947232 ATGGGAGAGATAAAGAAATTTGG + Intronic
1174324206 20:49766283-49766305 GTGTGAGAGAGAAAAGAAGTTGG + Intergenic
1175045599 20:56101996-56102018 ATGTGAAGGAAGAAGGAATTAGG + Intergenic
1176196331 20:63837783-63837805 TTCTGAGATAAAAAGGAACTGGG + Intergenic
1176882079 21:14207986-14208008 ATGTGAAAGAAAATGAAATTTGG - Intronic
1177024485 21:15905320-15905342 CTGTGAGAGAGTAAGGGCTTAGG - Intergenic
1177086154 21:16707248-16707270 GTGTGAGAAAAAAAGCAATAGGG + Intergenic
1177306476 21:19324678-19324700 CAGAGAGAGAATGAGGAATTGGG + Intergenic
1177506095 21:22018904-22018926 CTGTGGTAGGAAAAGGGATTAGG + Intergenic
1178702876 21:34848395-34848417 CGGTGAGCGAGAAAGGAGTTTGG - Intronic
1179278799 21:39916165-39916187 CTCAGAGAGAAGAAGGCATTTGG + Intronic
1180434786 22:15289866-15289888 CTGTAAGAGAAGTAAGAATTGGG - Intergenic
1180904178 22:19396948-19396970 CTGTGAAGAAAAAAGGAATGTGG + Intronic
1182251238 22:29002575-29002597 CTTTGAGAGAAAAATTAATTTGG - Intronic
1182322704 22:29488888-29488910 CTGGAAGCGAGAAAGGAATTGGG - Exonic
1182649236 22:31837160-31837182 GTGTCAGAGAAAAAGGCACTTGG + Intronic
1182744341 22:32594130-32594152 CAGTGGGAGACAAGGGAATTGGG + Intronic
1183104177 22:35604364-35604386 AGGTGAGAGCAAAAGGAATAAGG - Intergenic
1184561996 22:45268823-45268845 CTTTGAGAGGAAAAGGAGCTCGG + Intergenic
1185428043 22:50784602-50784624 CTGTGAAAGGAAAATGAATCTGG - Intergenic
949868006 3:8562592-8562614 CTGTGAGATAAATAGGAATGTGG + Intronic
950562448 3:13742114-13742136 CTGTGAGAGGAAAACAAATGAGG - Intergenic
950640285 3:14344164-14344186 CTGTGCCGGAGAAAGGAATTAGG - Intergenic
951365622 3:21778437-21778459 CTGTGAGATGAATAGGAAATGGG - Intronic
952489381 3:33851796-33851818 CTGGGAGAGGAAAAGGAAAGAGG - Intronic
952770711 3:36997538-36997560 GTATGAGAGAAAGAGGAATCAGG + Intronic
953157853 3:40391261-40391283 CAGTTAAAGAAAAAGAAATTAGG - Intronic
955443723 3:58984839-58984861 TTGTGAGAGTTAAAGGAACTTGG + Intronic
956274885 3:67488336-67488358 CTGTCAGAGAATTAGGAATTAGG - Intronic
956454548 3:69407919-69407941 ATGTGGGGGAAAAAGGAGTTAGG + Intronic
956517058 3:70061181-70061203 TTGGGGGAGAAAAATGAATTTGG + Intergenic
956567597 3:70656346-70656368 CTAGGGGAGGAAAAGGAATTAGG + Intergenic
956909378 3:73801646-73801668 CTTTGAAAGGAAAAGGAATTTGG - Intergenic
957208228 3:77226958-77226980 CTGTTAAAGAAAAATGAAGTTGG - Intronic
958001973 3:87761929-87761951 CTGTGGGACAACATGGAATTCGG - Intergenic
958111203 3:89147996-89148018 ATGAGAAAGAAAAAGGCATTTGG + Intronic
958918662 3:100078333-100078355 CTGTAACAGAAAAAAAAATTAGG - Intronic
958982108 3:100733816-100733838 CTCTAAAAGAAAAAGGTATTTGG + Intronic
958992716 3:100865793-100865815 CTTTGAGGGAGAAAGGGATTTGG + Intronic
959705491 3:109335430-109335452 CTCTCAGAGAAAAAGAAAATAGG - Intronic
960405906 3:117259300-117259322 GTGTGAGAAGAAAAGGTATTCGG - Intergenic
961136445 3:124515983-124516005 ATGTGTGAGAAATAGGAAATAGG - Intronic
961797882 3:129422805-129422827 CTGTGAGACAAAAAGGAATGGGG - Intronic
962723940 3:138203556-138203578 CTGTTAGAGAAAAAGGGAGGGGG + Intronic
963486361 3:145938828-145938850 CTCTGAGAGAAATAGAATTTGGG + Intergenic
964255731 3:154772545-154772567 CTGTGAGGGAAAACGGGATTGGG + Intergenic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
964870080 3:161303866-161303888 CCGGGAGAGAAGAAGGAATAGGG - Intergenic
965103474 3:164332539-164332561 CTGTGAGGGAGAGAGGAAGTGGG + Intergenic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
967263013 3:187663203-187663225 CTGGGAGAGAAAGAGGAAAAAGG + Intergenic
967398028 3:189028471-189028493 GTGGGAGACAAAGAGGAATTAGG + Intronic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
967606963 3:191458268-191458290 CTGTGAGAGAAATGGGAGGTGGG - Intergenic
968172486 3:196521763-196521785 CAAAGAGAGAAAAAGGAAATAGG + Intergenic
968767544 4:2481329-2481351 TTGTGAGGAAAAATGGAATTAGG - Intronic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
970408723 4:15787283-15787305 CTGAGAGAGATTAAGTAATTTGG + Intronic
970492576 4:16589891-16589913 CAGTGAGAAAAACTGGAATTTGG - Intronic
970964192 4:21909135-21909157 CTGGGAGAGAAAAAGAGAATAGG + Intronic
971057807 4:22933247-22933269 ATGGGAGAGAAAACAGAATTGGG + Intergenic
971131296 4:23813801-23813823 CTTTGAGAAAATAAGGATTTGGG + Exonic
971460450 4:26890256-26890278 CTGGGAGAGAGAAGGGAATGTGG + Intronic
972673046 4:41232296-41232318 ATGTGAGAGAAAGAGGACTCAGG + Intergenic
972689307 4:41381436-41381458 CTGTGAGGGAAACATGAATTTGG - Intronic
972865243 4:43224344-43224366 CTATTAGAGAAGAAGGATTTGGG - Intergenic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
975164054 4:71157200-71157222 CTATCAAAGAAAAAGGAAATTGG + Intergenic
975191895 4:71473839-71473861 CTCTCATAGAAAAAGGAATAGGG + Intronic
975781239 4:77842115-77842137 TTGAGAGAGAAAAAGCCATTGGG + Intergenic
976093384 4:81480402-81480424 CTGTGAGAGAGATAGGATTAGGG - Intronic
976564123 4:86533926-86533948 CTGTGAGATAAACAGGAAAATGG - Intronic
976894044 4:90085708-90085730 CTGAGAGAGAAGAGGGAATAGGG - Intergenic
977809787 4:101346385-101346407 CTGTGACAGAAATAGGAAGTGGG - Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978025891 4:103873750-103873772 CAGTGACAGAAAAAGGACCTCGG + Intergenic
978542595 4:109834643-109834665 CTGTGACAGAAAAAAAAATGGGG - Intronic
979641233 4:123014153-123014175 CTGGGAAAGATAAAGGAATATGG - Intronic
980573335 4:134652123-134652145 CTGTGAGAGGAAAAGTGATATGG + Intergenic
980660417 4:135850343-135850365 TTGTGAGATAAAAATGACTTAGG + Intergenic
980808932 4:137850859-137850881 TTGTGAGTAGAAAAGGAATTGGG - Intergenic
982286963 4:153745965-153745987 GTGTGAGAAAAACATGAATTTGG - Intronic
984205423 4:176782165-176782187 TTGTAAGAGAAAAAGAAATTAGG + Intronic
984409160 4:179372708-179372730 CTGTTAAACAAAAAGGAATCAGG - Intergenic
984957842 4:185063445-185063467 CTGTGTGAGTAAAAGAAACTTGG - Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985322490 4:188730525-188730547 CTGGGAGAGACAAAGGTGTTGGG - Intergenic
986711577 5:10491771-10491793 CTGCGAGAGAAACAGGGGTTCGG + Intergenic
987393133 5:17395801-17395823 CTGGGATAGAAAAAGACATTAGG - Intergenic
987970827 5:24941549-24941571 ATATGACAGAAAAAGTAATTTGG - Intergenic
988090927 5:26540765-26540787 CTGTGAGTTTAAAAGGAATAAGG + Intergenic
988385008 5:30551619-30551641 CAGAGAGAGAAAAAGGAATGGGG + Intergenic
989151997 5:38308784-38308806 CTGTGGGAGAAGAAAGAATCCGG + Intronic
989483493 5:41961284-41961306 CAGTGAGAGAAAAAAAGATTGGG - Intergenic
989722815 5:44550151-44550173 ATGTGAGAGAAAAATGTTTTAGG - Intergenic
990025391 5:51181332-51181354 GTGTGAGAGAAACAGCCATTAGG - Intergenic
990656196 5:57958804-57958826 CTGTGTGAGACTAAGGAAATTGG + Intergenic
990833512 5:59987436-59987458 CTGTGTTAGAAAAAGGTATGAGG - Intronic
991041387 5:62179155-62179177 CTGTAAGGTAAAAAAGAATTGGG - Intergenic
991503181 5:67297909-67297931 CTGTGAGAGGGACAGGAATGTGG - Intergenic
991606797 5:68410474-68410496 CTGTGCAATAAAAAGGAGTTTGG - Intergenic
991665061 5:68991427-68991449 GGGAGAGAGAAAGAGGAATTAGG - Intergenic
992128338 5:73665871-73665893 TTGTGAGAAGAACAGGAATTTGG - Intronic
993090380 5:83418647-83418669 CTGTGAGAGAAAGGGGACATGGG + Intergenic
993364650 5:87020573-87020595 CTGAGAGAGAAAAAGGACACTGG - Intergenic
993601585 5:89932576-89932598 TTGAGAGAGAAGAAGGTATTAGG + Intergenic
993622139 5:90180863-90180885 CTCTGGGAGAAAAATGAATTTGG - Intergenic
994122560 5:96133359-96133381 TTTTGAGAGAAAAAGGATGTGGG + Intergenic
994178146 5:96734465-96734487 CTGTGATAGAATAAGAAAGTGGG + Intronic
994248694 5:97511491-97511513 CTGTGAAAGAAAAATAACTTGGG + Intergenic
994742471 5:103638159-103638181 GAGAGAGAGAAAAAAGAATTAGG - Intergenic
994750873 5:103735451-103735473 CTTTGAAAGAAATATGAATTGGG + Intergenic
995354634 5:111224135-111224157 CTGGGAGAGAGAAAGGAAAGAGG + Exonic
995865445 5:116685393-116685415 TAGAGAGAGAAAAATGAATTCGG + Intergenic
996332138 5:122341878-122341900 TTGTGAGAGACAAAGGATTTTGG - Intronic
996810131 5:127507290-127507312 CTGGAACAGAAAAAGGCATTAGG - Intergenic
996961751 5:129258856-129258878 CTATGGGAGAAATATGAATTAGG - Intergenic
997048682 5:130351861-130351883 CTGTGAGTTCAAAAGCAATTAGG + Intergenic
997145671 5:131430423-131430445 CAGTGAGAGAAAATGCAATCAGG - Intronic
997224175 5:132196385-132196407 CTGTAAGAGAAAAGGAACTTGGG - Intronic
997447545 5:133952394-133952416 TTGTGAGAGAAAGAGGCATAGGG + Intergenic
999757039 5:154672177-154672199 ATGTCAGGGAAAAAGAAATTGGG - Intergenic
999857775 5:155613880-155613902 CTGTGAGTGGAACAGGAATTTGG + Intergenic
1000642937 5:163725763-163725785 ATGTTAAAGAAAAAGTAATTTGG + Intergenic
1001067162 5:168545125-168545147 CTGGGAGAGAAAGAGAGATTGGG + Intergenic
1002388684 5:178891912-178891934 CTGTGGGAGAACAAGGGACTAGG - Intergenic
1002561485 5:180085035-180085057 CTGTGAGAGAAGACGGCCTTGGG - Intergenic
1002796738 6:477530-477552 CTGGGAGAGGACAAGGAATATGG - Intergenic
1002878112 6:1228955-1228977 CTGTGAGAGAGTGAGGAGTTTGG - Intergenic
1003337783 6:5191090-5191112 CTGTAATAGAAAAAAAAATTAGG + Intronic
1003712539 6:8608796-8608818 CTTACAGAGAAAAAGAAATTAGG - Intergenic
1004749876 6:18551363-18551385 CTGTAAAAGGAAAAGTAATTGGG + Intergenic
1005057278 6:21741451-21741473 CTGTGGGAGAGAAAGGCTTTTGG + Intergenic
1005148954 6:22725691-22725713 ATGTGAGTGAAAAAGCCATTTGG - Intergenic
1005869626 6:29965120-29965142 GTGTGAGACAGAAAGGAAATGGG + Intergenic
1006255160 6:32826927-32826949 TTGTGGGAGAGAAAGGAATCAGG + Intronic
1006395789 6:33786733-33786755 CTGTGAGAGAAAAACAGATGAGG - Exonic
1006739830 6:36300048-36300070 CTGGAACAGAAAAAGAAATTAGG - Intronic
1007671426 6:43557593-43557615 CTGGGAGAGATGAGGGAATTGGG + Intronic
1008026160 6:46638387-46638409 CTGTGAGAAATTAGGGAATTTGG - Intronic
1008089471 6:47278978-47279000 AGGTGAGAGACAAAGGAATTGGG - Intronic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1009706428 6:67258119-67258141 ATGTGAGTGAAAAAGCCATTTGG + Intergenic
1011046266 6:83086836-83086858 CTATGAGAGAATAAAGAAATGGG + Intronic
1011506054 6:88045351-88045373 CTGTGAGATAAAATCGATTTTGG - Intergenic
1011853585 6:91661065-91661087 TTGTGGGAGAAAAAGAAAGTGGG + Intergenic
1013302545 6:108818103-108818125 CTGTGACAGAAGAAGGACCTGGG - Intergenic
1014212742 6:118723327-118723349 CTGTGATACAACAAGGACTTAGG - Intergenic
1014399888 6:120975291-120975313 ATTTGAGAGAAAAAGAAATGAGG - Intergenic
1014611657 6:123555288-123555310 ATGGGAGAAAAAAAGGCATTTGG - Intronic
1015364233 6:132379012-132379034 CTGGTATAAAAAAAGGAATTAGG - Intronic
1015449291 6:133346456-133346478 CTTTCTGAGAAAAATGAATTTGG - Intronic
1015456665 6:133434161-133434183 CTGAGAGAGAAAAAGCTCTTGGG + Intronic
1015997153 6:139006993-139007015 CTCAGAGAGAAAAAAGAAGTAGG + Intergenic
1016131933 6:140484666-140484688 CTGTGCCAGGAAGAGGAATTAGG - Intergenic
1016158667 6:140847404-140847426 TTGTAAGAAAAAAAGGAAGTTGG + Intergenic
1016191155 6:141266615-141266637 CACTGAAAGAAAAAGGAAGTCGG + Intergenic
1016430277 6:143976755-143976777 TTGTGAGAGAAGATAGAATTAGG - Intronic
1016434849 6:144025362-144025384 CTGGAATAGAAAAAGGACTTAGG + Intronic
1016447452 6:144148650-144148672 CTGGGACAGAAAAAGGACTTGGG - Intergenic
1016844039 6:148553710-148553732 CTGTGAGAGAGAAAGGGAGGAGG + Intergenic
1017915708 6:158830176-158830198 CTCAAAGAGAAAAAAGAATTGGG - Intergenic
1021501562 7:21337338-21337360 CTGTGAAAGGAAAATGCATTTGG - Intergenic
1021815490 7:24443448-24443470 CTGAGAGAGAAAAAGGAATTTGG - Intergenic
1022170699 7:27826590-27826612 CTGAGAGATAAAAAGGAAATAGG + Intronic
1022584167 7:31589399-31589421 CTGTGCGAGAAAAAAATATTTGG + Intronic
1022891848 7:34709052-34709074 CTGTGAGGGAAAAAGGAATAAGG + Intronic
1023203854 7:37726920-37726942 ATGGGAGAAAAAGAGGAATTAGG + Intronic
1023581518 7:41689408-41689430 CAGTGAAAGAGACAGGAATTGGG - Exonic
1023977190 7:45039302-45039324 GCTTGAAAGAAAAAGGAATTGGG - Intronic
1025115960 7:56258309-56258331 CTGTGAGAGGAAAATAAATCTGG - Intergenic
1026160207 7:67862042-67862064 ATGTGTGGGAAACAGGAATTGGG + Intergenic
1026262836 7:68770633-68770655 CAGAGAGAGAAGAAGGAAATAGG + Intergenic
1026266935 7:68803419-68803441 TTCAGAGAGAAAAAGGGATTGGG + Intergenic
1028717082 7:93983196-93983218 CACTGATAGAAAAAGGTATTTGG + Intronic
1029491225 7:100871333-100871355 CTATGAGAAAAACAGGAATCAGG - Intronic
1030634402 7:111932211-111932233 CTGGGAGATGAAAAGGAGTTGGG + Intronic
1030655164 7:112159562-112159584 CTGTTAGAGCAAAAGAAATACGG - Intronic
1031073461 7:117189298-117189320 CTGTTGGAGAAAAAGAAAGTAGG - Intronic
1032695501 7:134332576-134332598 CTGTGAGAGAGATAGGAAAAGGG - Intergenic
1033855509 7:145556613-145556635 CTGAGAGAGAAAGAGGGAGTGGG - Intergenic
1033919775 7:146376285-146376307 CTCTAAGAGAGTAAGGAATTCGG - Intronic
1034126059 7:148672507-148672529 CTTTCAAAGTAAAAGGAATTTGG + Intergenic
1037041267 8:14237956-14237978 CTGGGAGAGAAAAAGGAAAAGGG - Intronic
1037067247 8:14597331-14597353 ATGGGAGAGAAAAAGTACTTAGG + Intronic
1037269248 8:17108077-17108099 TTATAAGAGAAAAAGGAATCAGG + Intronic
1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG + Intronic
1037897768 8:22669431-22669453 CTGTGGGAGAAGAAGCCATTTGG + Intergenic
1037991732 8:23326239-23326261 CTCTGGGAGAAAGAGGCATTTGG - Intronic
1038252695 8:25920624-25920646 CTATGAGGGAGAAAGAAATTTGG + Intronic
1038759410 8:30372889-30372911 ATGTGAGAAAAACATGAATTTGG - Intergenic
1038892551 8:31742794-31742816 CTGTGAGAGGAGAAAGAATGGGG + Intronic
1039137422 8:34341154-34341176 TTTTGAGGAAAAAAGGAATTAGG + Intergenic
1039984515 8:42436426-42436448 ATGTGAGAGAAGAAGGAAAGAGG - Intronic
1040096169 8:43445264-43445286 CTTTTAGAGTAAAAGGCATTAGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041495281 8:58479345-58479367 CTGAGAGAGAAAAATCAATAAGG - Intergenic
1042088048 8:65130206-65130228 CTGTGAGAAAAAAAAAAAGTCGG - Intergenic
1042517744 8:69677572-69677594 CTCTGAGAAATAAAGAAATTGGG - Intronic
1042566649 8:70118202-70118224 CTATGGGAGAAAAATGGATTTGG - Intronic
1042583388 8:70307059-70307081 CTTTGAGGGAATAAGGAGTTGGG - Intronic
1043058021 8:75464918-75464940 TTGGGAGAGGAAAAGGAATGAGG + Intronic
1043586807 8:81779505-81779527 CTGAGAGTGAAAATGGGATTTGG + Intergenic
1043614800 8:82112749-82112771 TTGAGAGAGAAAAATGAAGTTGG + Intergenic
1044327955 8:90881870-90881892 CACTGAGAGATAAAGGAAGTTGG + Intronic
1044752656 8:95431092-95431114 CTGGGAGAGAAAAAGTATCTAGG - Intergenic
1045586252 8:103540280-103540302 CGGTGGGAGAAAAAGAAATTGGG + Intronic
1046068842 8:109225953-109225975 ATGAGAGAGAAAAAGGTATGGGG - Intergenic
1047327760 8:123856423-123856445 CTGTGAGAGAAGGAAGAACTTGG + Intronic
1047347255 8:124040244-124040266 CTGGGAGAAAAAGAGGAATGAGG + Intronic
1048058667 8:130894466-130894488 CTGTGAGATAGTAAGGACTTTGG - Intronic
1048408430 8:134146574-134146596 CTTAGAGAGGTAAAGGAATTTGG + Intergenic
1048924019 8:139254631-139254653 CTGTGCGAAAATAAGTAATTTGG - Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049715577 8:144088839-144088861 CTGTTAGATATAAAGGAATAAGG - Intergenic
1050379598 9:5013089-5013111 CTTTGAGATAATAAAGAATTTGG - Intronic
1050693920 9:8258933-8258955 CTGGGAGAGAAATGGGAACTAGG + Intergenic
1052108976 9:24556030-24556052 CTTAGAGAGACAAAGGAATTTGG + Intergenic
1052459932 9:28750076-28750098 CTGTGAGTAAAAAGAGAATTGGG - Intergenic
1052871177 9:33508244-33508266 CGGTGAGAAAAACAGGTATTGGG + Intergenic
1052998869 9:34566306-34566328 CTGTCAGAGAAGAAGGAAGCAGG + Intronic
1053033151 9:34800349-34800371 CTGAGAGAGAAAAATGAAACAGG + Intergenic
1053172212 9:35896217-35896239 AAGGGAGAGAAAAAAGAATTTGG + Intergenic
1053415969 9:37946931-37946953 CTGTGAGAGGTAAAGGAAGCAGG - Intronic
1054958024 9:70935458-70935480 CTGTGAGAGAAAAACATGTTAGG - Intronic
1055403869 9:75953592-75953614 CTGTGAAAGCAAAAACAATTTGG + Intronic
1055809038 9:80130262-80130284 CTTTAAGAAAAAGAGGAATTGGG + Intergenic
1055977599 9:81969958-81969980 CTCTGACAGAAAAAGTAACTGGG + Intergenic
1056346800 9:85705003-85705025 AAGAGAGAGAAAAAAGAATTAGG + Intronic
1056725705 9:89113865-89113887 ATGTCAGAGAAATATGAATTAGG + Intronic
1057052657 9:91937394-91937416 CTGTTAGAGAAATGGGAGTTCGG - Intronic
1057980522 9:99657568-99657590 CTGTCAGATAAACAGAAATTTGG - Intergenic
1058234546 9:102473414-102473436 CTATGGGAGAAAAAGGAAAAGGG + Intergenic
1060006147 9:120001582-120001604 CTTTGAGGGAAAAAAAAATTGGG + Intergenic
1060340772 9:122774931-122774953 CTGTTAGAGAAAAAGGATACTGG - Intergenic
1060378954 9:123147055-123147077 CTGTTAAAGAAAGAGGAATGAGG + Intronic
1060684266 9:125594017-125594039 GTGAGACAGAAAGAGGAATTAGG - Intronic
1061201346 9:129140297-129140319 GAGTGGGAGAAAAAGGAATCGGG - Intronic
1062199080 9:135291498-135291520 GTGTGAGAGATAAAGGAAGAAGG + Intergenic
1186014889 X:5180258-5180280 GTGTGAGAGAGAGAGGAAATAGG - Intergenic
1186105576 X:6202202-6202224 CTGTCAGAAAAAAAGGTATAAGG + Intronic
1186142836 X:6595080-6595102 CTGTCAAAAAAAATGGAATTGGG + Intergenic
1186390304 X:9152046-9152068 ATGTGTGAGAAACAGGAACTAGG + Intronic
1187550425 X:20297436-20297458 TTGTGGGAGAAACAGGAATGAGG + Intergenic
1188797760 X:34486159-34486181 CTGTCAGAGAAATGGGAACTTGG + Intergenic
1188866022 X:35313887-35313909 GGGAGAGAGAAAAAGAAATTGGG - Intergenic
1188914937 X:35898706-35898728 CTATGACAAAAGAAGGAATTGGG - Intergenic
1188918546 X:35942737-35942759 CTGTAAGTAAAAAAGGAATATGG + Intronic
1188946581 X:36312375-36312397 CTGTTGGAGAAAAAGGAACATGG + Intronic
1189357927 X:40325545-40325567 CTGTGAGGAAAAAAAGAAATGGG - Intergenic
1189408669 X:40749615-40749637 CTGTTAAACACAAAGGAATTGGG + Intergenic
1190035029 X:47014553-47014575 CTATTAGAGCAATAGGAATTTGG - Intronic
1191925275 X:66302366-66302388 CGGGGAGAGAAAGAGGAGTTGGG - Intergenic
1192069117 X:67918345-67918367 CTGTGAAAGAAAAGGGCTTTTGG + Intergenic
1193238280 X:79135614-79135636 CTGTGAGAGAAAAAAATAGTAGG - Intergenic
1194166531 X:90522780-90522802 TTGTGAAAGAAAAATAAATTTGG + Intergenic
1194816528 X:98448300-98448322 CTGTAATAGTAAAATGAATTAGG - Intergenic
1194895080 X:99430570-99430592 CTGTGAGAGAAAAAAAGATCAGG + Intergenic
1194904473 X:99557735-99557757 CTGTGGGAGAAAATGTTATTAGG - Intergenic
1196161068 X:112483164-112483186 CTGTGAAAGAAAAACAAAGTTGG - Intergenic
1196175379 X:112634255-112634277 CTGTAAGAGAAAAATGCTTTTGG - Intronic
1196210946 X:112995051-112995073 GTGTGAGAGAAATAGCAATCGGG + Intergenic
1196288161 X:113906655-113906677 ATGTGAGAAAAATAGCAATTTGG + Intergenic
1196681752 X:118476515-118476537 ATGTGAGAGAAAGAGGAGTCTGG + Intergenic
1196769803 X:119282120-119282142 CTGTGAGAGAAGAAAGAAAATGG - Intergenic
1197011081 X:121564433-121564455 CTAAGAGAGAAAAAGGCAATAGG - Intergenic
1197650307 X:129056906-129056928 CTGACAGAGATAAAGTAATTTGG - Intergenic
1197673090 X:129300034-129300056 CTGTGAGAAGAATATGAATTTGG + Intergenic
1197868627 X:131044888-131044910 CAGTGAAAGAAAAAGGGATGAGG - Intergenic
1198064141 X:133079313-133079335 TTGTGAGAGTAGAAGGAGTTAGG - Intronic
1198298538 X:135310631-135310653 TTGTGAGAGCACAGGGAATTGGG - Intronic
1199155766 X:144547216-144547238 CTCTGAGATAAATAGGAATCTGG + Intergenic
1200512799 Y:4100561-4100583 TTGTGAAAGAAAAATAAATTTGG + Intergenic
1201634706 Y:16109889-16109911 CTGTTTGTGAACAAGGAATTGGG - Intergenic
1201652640 Y:16307321-16307343 CTGTGAGAGGAAGAGGTATGAGG - Intergenic