ID: 966389632

View in Genome Browser
Species Human (GRCh38)
Location 3:179438409-179438431
Sequence TTCCCAAAACAATCCCATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966389632_966389637 26 Left 966389632 3:179438409-179438431 CCCCTATGGGATTGTTTTGGGAA 0: 1
1: 0
2: 0
3: 15
4: 148
Right 966389637 3:179438458-179438480 TTGGGAAATTTAAGTCAATTTGG 0: 1
1: 0
2: 1
3: 27
4: 232
966389632_966389636 8 Left 966389632 3:179438409-179438431 CCCCTATGGGATTGTTTTGGGAA 0: 1
1: 0
2: 0
3: 15
4: 148
Right 966389636 3:179438440-179438462 TACACATTTTTTAATGTCTTGGG 0: 1
1: 0
2: 6
3: 59
4: 654
966389632_966389635 7 Left 966389632 3:179438409-179438431 CCCCTATGGGATTGTTTTGGGAA 0: 1
1: 0
2: 0
3: 15
4: 148
Right 966389635 3:179438439-179438461 ATACACATTTTTTAATGTCTTGG 0: 1
1: 1
2: 7
3: 62
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966389632 Original CRISPR TTCCCAAAACAATCCCATAG GGG (reversed) Intronic
901806301 1:11740793-11740815 TTTCCAAAACAAGCCCAGAGTGG + Intronic
908199617 1:61780821-61780843 TTCCCAGATTAATCCCATTGAGG + Intronic
910545124 1:88407370-88407392 TTCCCCTAACAATCCCTTCGAGG + Intergenic
910551190 1:88477403-88477425 TCTCCAAAACAATCACATTGGGG - Intergenic
917337966 1:173944836-173944858 TTCCAAAAACAATCTCCTACTGG + Intronic
919172987 1:193979790-193979812 TGCAAAAAACAATCCCAAAGAGG - Intergenic
921888081 1:220326413-220326435 TTCCCAGAATAGTCCCATTGTGG + Intergenic
923680292 1:236113325-236113347 TTACCAAAGCAGTCCCACAGTGG + Intergenic
923862835 1:237908907-237908929 CTACCAAAACAACCCTATAGAGG - Intergenic
923906615 1:238392024-238392046 TTCCCAAAAGAGTCCCAAAGGGG - Intergenic
924102391 1:240618135-240618157 AGCCCAAAACGATCCCAGAGAGG - Intergenic
924240257 1:242033317-242033339 TTCCTAATACCATCCCATCGGGG + Intergenic
1063560286 10:7119810-7119832 TTCCCATGACAATGCTATAGGGG - Intergenic
1066683034 10:37953876-37953898 TTCCCAAAACAATGGGCTAGAGG - Intronic
1066981966 10:42424657-42424679 TCCCCACAACAAACCTATAGAGG - Intergenic
1069599191 10:69692595-69692617 TTCTAAAAAGAACCCCATAGGGG - Intergenic
1071237668 10:83667986-83668008 TTCCTAATACCATCACATAGAGG - Intergenic
1071726775 10:88206322-88206344 TTTCCAGAACAATGCCAGAGGGG + Intergenic
1071977214 10:90967197-90967219 TTCCTAAAACAAACCCATATTGG + Intergenic
1073696066 10:105869596-105869618 TTCCCCAAACAATGCTCTAGGGG + Intergenic
1074887532 10:117705764-117705786 TTCCCAAAGAAAGCCCAAAGAGG + Intergenic
1074987290 10:118669485-118669507 TGACCAAAACAGTCCCATGGCGG - Intergenic
1075297410 10:121290520-121290542 TTCTCAGAACAATGCCTTAGGGG - Intergenic
1075482421 10:122793626-122793648 TGCCCAAAACCAGACCATAGTGG + Intergenic
1076275728 10:129196843-129196865 TCCCCAACACAAATCCATAGTGG + Intergenic
1079782006 11:24618804-24618826 TTTCCAAAACATTGGCATAGAGG - Intronic
1080425733 11:32152468-32152490 TTTCCAGAACAATCCCCCAGAGG - Intergenic
1080598513 11:33799301-33799323 TTGCCAAAACAATTCAATGGAGG + Intergenic
1081182451 11:40000784-40000806 TTACCAATACTATCACATAGGGG - Intergenic
1081310591 11:41566670-41566692 TTCCCAATGCAATTACATAGGGG - Intergenic
1083848916 11:65354377-65354399 TTCCCAAAACAATTCCGTGAGGG + Intergenic
1090578929 11:128138893-128138915 TTCCCAAAACTTACCCAAAGGGG - Intergenic
1091006990 11:131962372-131962394 CTCCCAAAACTATCCCATTGAGG - Intronic
1091238193 11:134035428-134035450 TTCCCACAACATTGCCATAATGG + Intergenic
1091856511 12:3745073-3745095 TTCCCTACAGAATCCCACAGAGG - Intronic
1094217614 12:27960973-27960995 CTCCCAACACAATCCAACAGAGG - Intronic
1104182427 12:126395496-126395518 TTCCCACCACAATCTCATACTGG - Intergenic
1104630148 12:130393645-130393667 TTCACAAAAAAATCCAATACCGG - Intergenic
1105358071 13:19678365-19678387 TACCCAAAACATTTCAATAGAGG + Intronic
1106627180 13:31432685-31432707 TTCCAAAAAGAATCTCATATGGG - Intergenic
1107280889 13:38733534-38733556 TTCCTAAAACATTCCATTAGTGG - Intronic
1108070018 13:46618893-46618915 TTCCCAAAACAAACCCACATGGG - Intronic
1113095419 13:106658622-106658644 TTCTCAAAACCATACAATAGGGG - Intergenic
1114886356 14:26856794-26856816 TTCCTAAAACAATTTCTTAGGGG + Intergenic
1117855071 14:60021749-60021771 GTGCCAAAACAATTCAATAGAGG - Intronic
1118693506 14:68362130-68362152 TTCTCACAACAATCCCATGAGGG - Intronic
1118737710 14:68714074-68714096 CTCCCAGAAAAATCCCAAAGAGG + Intronic
1119663432 14:76467153-76467175 ATTGCAAAGCAATCCCATAGTGG - Intronic
1124363989 15:29058915-29058937 TTCCCAAAACACGCTCTTAGAGG + Intronic
1124500097 15:30220826-30220848 TTCCCACAACAATGTCACAGTGG - Intergenic
1124743478 15:32317840-32317862 TTCCCACAACAATGTCACAGTGG + Intergenic
1124835625 15:33194135-33194157 TTCCCAATGCAATCCCATTGTGG + Intronic
1128663343 15:69519575-69519597 GTTCCAAAACCATTCCATAGGGG + Intergenic
1129209576 15:74059883-74059905 TTCCAAATACAATCATATAGTGG - Intergenic
1129835708 15:78704141-78704163 TTCCAAATACAATCACATAGGGG + Intronic
1131560950 15:93438835-93438857 TCACAAAAACAATCCCATATCGG - Intergenic
1133560888 16:6949267-6949289 TTCACAAAACAAACCCATAAAGG + Intronic
1134339864 16:13335056-13335078 TTCCCAAATTAGTCCCATGGGGG + Intergenic
1136495440 16:30640540-30640562 TTCACAAAACAACCCCTAAGGGG + Intergenic
1141254571 16:82388719-82388741 TCCTCAAAACAATCCCATGGAGG - Intergenic
1143029947 17:3962346-3962368 TCCCCAAAACAACTCCATAAGGG - Intronic
1150847712 17:68676571-68676593 TTCCCAAAACCATCCTACTGGGG + Intergenic
1156962394 18:43048549-43048571 TTTTCATAACAACCCCATAGTGG - Intronic
1159240395 18:65735331-65735353 TTCACAATACTATACCATAGGGG + Intergenic
1163083076 19:14957387-14957409 CTCCCAATACTATCCCATTGGGG - Intronic
1163296964 19:16418671-16418693 CTCCCAACACCATCCCATTGAGG - Intronic
1165202954 19:34160015-34160037 TTCCCAATACCATCCCCTTGAGG - Intergenic
1165809163 19:38600297-38600319 TTCCCCAAACAAAGCCAGAGCGG + Intronic
1168566008 19:57424400-57424422 TTCTCAAAACACTCTCATTGCGG + Intronic
931519759 2:63082787-63082809 TTCCCCAAACAATTTCATTGTGG + Intergenic
932368423 2:71167654-71167676 TTCTCCAAACCATCCCAAAGGGG - Intergenic
933351490 2:81157820-81157842 TTACCACGAGAATCCCATAGAGG - Intergenic
933893411 2:86790490-86790512 CTCCCAAAACAAGCCCAAGGCGG - Exonic
935673587 2:105575847-105575869 TTCCCAAACCCATCCAATAATGG + Intergenic
937288842 2:120769800-120769822 TTCCCAACACACTCCCAAACAGG - Intronic
939767195 2:146265689-146265711 TTCCCAAAACAGCCCAATAAAGG - Intergenic
940878847 2:158925514-158925536 CTCCCAACACCATCCCATTGAGG + Intergenic
941049951 2:160721670-160721692 TTCCTAATACCATCCCATTGGGG - Intergenic
943128356 2:183825486-183825508 TGCCCAAATCAATGCCATGGTGG - Intergenic
943197711 2:184776624-184776646 TTCCCAAAACAATCCTCAGGTGG - Intronic
947811996 2:233010678-233010700 TTCCCAAAAGCAGCCCACAGAGG + Intronic
948526309 2:238573000-238573022 TTCCCACCACAATCCTATAAAGG - Intergenic
1175680966 20:60988619-60988641 CTCCGAAAACCATCCCATGGGGG - Intergenic
1175978805 20:62726901-62726923 TTCTCAAAACCATCCCAGTGTGG - Intronic
1176693297 21:9944113-9944135 TTGCCTAAACATGCCCATAGTGG - Intergenic
1177264737 21:18767493-18767515 TTCCAAAAACAGTCACATTGTGG + Intergenic
1177409954 21:20717260-20717282 TTCCAAATACCATCCCATTGAGG - Intergenic
1177912164 21:27046268-27046290 TTCCAAATACAATCACATAAGGG + Intergenic
1179397176 21:41051419-41051441 TTCCCAACACAACACCCTAGGGG + Intergenic
1183681701 22:39334678-39334700 TTCCCATAACAATACCACTGAGG - Intergenic
949089857 3:14223-14245 TTCCCAAAATAATCCAGCAGAGG - Intergenic
950095614 3:10328544-10328566 TTCCCAAAACAAGCCCTTCCTGG - Exonic
950391575 3:12700964-12700986 TTCCAATAACAATCCCCTCGGGG - Intergenic
951483208 3:23183617-23183639 GTCCCAAAACAAACCAACAGGGG + Intergenic
951704822 3:25533668-25533690 ATCATAAAACGATCCCATAGAGG + Intronic
957029533 3:75223958-75223980 TTCCCAAAATAATCCAGCAGAGG - Intergenic
959180963 3:102980075-102980097 TTCCCATAAAAATCCCACATGGG - Intergenic
965066500 3:163857030-163857052 TTGCCCTAAAAATCCCATAGTGG - Intergenic
966389632 3:179438409-179438431 TTCCCAAAACAATCCCATAGGGG - Intronic
968140646 3:196253401-196253423 TTCCCTAAACAAGTCCAGAGGGG + Intronic
970172079 4:13300314-13300336 TCCCCAAAACATTCTCAGAGAGG - Intergenic
971545632 4:27881546-27881568 TTGCCAAGACAATTCCAAAGTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972667336 4:41179791-41179813 TTCCCAAAACAGACACATACTGG + Intronic
976107682 4:81636632-81636654 GTACCAAAACAATTCCATGGGGG + Intronic
976330575 4:83826483-83826505 TTCCAAATACAATCCCACCGGGG + Intergenic
979167366 4:117552650-117552672 TTCTCAAAACAATCTTATATTGG + Intergenic
980281192 4:130722523-130722545 TTCCCAATACAATCACACTGGGG - Intergenic
980365908 4:131804340-131804362 TTGCCTAAACATGCCCATAGTGG - Intergenic
981385575 4:144126445-144126467 TTTCCTCAACAATCTCATAGTGG + Intronic
985344449 4:188988369-188988391 AGTCCATAACAATCCCATAGGGG - Intergenic
987204411 5:15610251-15610273 TTCTCAGAAGAATCCCAGAGAGG + Intronic
987322523 5:16783971-16783993 TTCCCACAATAATCCCATGAGGG + Intronic
988924951 5:35980444-35980466 TTCACAAAACAATACCAGAGGGG + Intronic
989734740 5:44690310-44690332 TTCTCACAACACTCCTATAGAGG + Intergenic
990907241 5:60817510-60817532 TTGCCAAATCACTCCCATAGAGG - Intronic
997889298 5:137660811-137660833 ATCCCCAAACAATCCTATAAAGG + Intronic
998706918 5:144772632-144772654 TTCCCACAACAATCCTTTGGGGG + Intergenic
1000231212 5:159316899-159316921 CTCCCAAAACAAGCCCATCTTGG + Intronic
1001845203 5:174916120-174916142 TTCCAAATACAATCATATAGGGG - Intergenic
1001950429 5:175812747-175812769 TCCCCAAACCCATCCCATAATGG - Intronic
1005369804 6:25120433-25120455 ATGCCAAAACAATTCAATAGGGG + Intergenic
1010713522 6:79203238-79203260 TTCCCAAATTCCTCCCATAGTGG + Intronic
1015057949 6:128926972-128926994 TACCCAAAACTATACCTTAGAGG - Intronic
1017378309 6:153797214-153797236 TACCCAAAAGAATCCTCTAGAGG - Intergenic
1018351610 6:162965591-162965613 TTCCTAACACCATCACATAGGGG + Intronic
1018500952 6:164410835-164410857 TGCATAAAACCATCCCATAGTGG + Intergenic
1020215143 7:6184361-6184383 TTCCTAACACAATACCACAGAGG - Intronic
1020762785 7:12289168-12289190 TTTCCAAAACTATACCATTGTGG - Intergenic
1021403575 7:20237958-20237980 GTCACAAAACAATCTCATTGTGG + Intergenic
1026367025 7:69658890-69658912 TTCACTAAACAATTTCATAGTGG - Intronic
1026670211 7:72383651-72383673 TTCCCAGAACACTTCCTTAGAGG - Intronic
1028420698 7:90629510-90629532 TTTCCAAAACACTCCATTAGAGG - Intronic
1028738144 7:94241121-94241143 TACACAAAACAATCGCATTGGGG + Intergenic
1030649518 7:112102160-112102182 ATCCATAAACAATCCCAGAGTGG - Intronic
1030765634 7:113405845-113405867 TTCCCAAATCCCTCCTATAGGGG + Intergenic
1031121107 7:117723540-117723562 TTCCCAAAACAAATCCAAATTGG - Intronic
1033435179 7:141327207-141327229 TGCCCAGAAAAATCCCATAATGG + Intronic
1033763558 7:144463194-144463216 GCCCCAAAACCATCCCACAGGGG + Intronic
1034872105 7:154694235-154694257 TTCCTAATACCATCCCATTGGGG + Intronic
1035902228 8:3469492-3469514 TTAACAAAACAGTCACATAGGGG + Intronic
1040949877 8:52926756-52926778 TTCCCCAAAAAATAGCATAGTGG + Intergenic
1042418037 8:68548935-68548957 CTCCAAATACAATCCCATTGGGG - Intronic
1042603007 8:70517843-70517865 TTGCCAAAACAATTCAATAGAGG - Intergenic
1042828986 8:73006815-73006837 CTCCCAATACCATCCCATTGGGG + Intergenic
1047052627 8:121129839-121129861 TTCCAAAAACAATTTAATAGTGG - Intergenic
1048667057 8:136674305-136674327 TTCATAAAACAATGCCATCGTGG - Intergenic
1052001944 9:23294479-23294501 TTTGCAAAACAATTCAATAGTGG + Intergenic
1053630254 9:39930200-39930222 TTGCCTAAACATGCCCATAGTGG - Intergenic
1053775516 9:41533328-41533350 TTGCCTAAACATGCCCATAGTGG + Intergenic
1054213633 9:62320502-62320524 TTGCCTAAACATGCCCATAGTGG + Intergenic
1055183275 9:73417050-73417072 CTCCCAAAACAGTCACATGGTGG - Intergenic
1058436325 9:104967118-104967140 TTCCCAAATGACTCCCATGGAGG + Intergenic
1059660069 9:116391721-116391743 TTGCTAACACAATCCCAGAGTGG + Intronic
1061663701 9:132148003-132148025 TCCTCAAAACAATCCCATGGGGG + Intergenic
1185948286 X:4402033-4402055 TTCCCAATACTATCCTATTGGGG - Intergenic
1189478317 X:41374334-41374356 CTCCAAATACAATCCCATTGTGG - Intergenic
1192163661 X:68808892-68808914 TGCCCCAAAGAATCCCAGAGAGG - Intergenic
1194356988 X:92897725-92897747 TTCCAAATACCATCCCATTGTGG - Intergenic
1195420148 X:104666376-104666398 GTCCGAAAACAATTCCATGGGGG + Intronic
1195571307 X:106401354-106401376 TGCCCAAAAATATCCCATAGTGG - Intergenic
1196903661 X:120410992-120411014 TTGCCCTAAAAATCCCATAGTGG + Intergenic
1199813299 X:151372019-151372041 TTCCCAACACCATTCAATAGTGG + Intergenic
1200970910 Y:9151319-9151341 TTCCCAACACAATCATATACAGG + Intergenic