ID: 966393205

View in Genome Browser
Species Human (GRCh38)
Location 3:179474858-179474880
Sequence CTTTGGGAGGGCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270098
Summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966393205_966393217 23 Left 966393205 3:179474858-179474880 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 966393217 3:179474904-179474926 ACTGTACTTGGTTCAAGACTGGG No data
966393205_966393214 11 Left 966393205 3:179474858-179474880 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 966393214 3:179474892-179474914 CAGGCATGAGCCACTGTACTTGG 0: 40
1: 1535
2: 18723
3: 59364
4: 120130
966393205_966393216 22 Left 966393205 3:179474858-179474880 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 966393216 3:179474903-179474925 CACTGTACTTGGTTCAAGACTGG No data
966393205_966393211 -8 Left 966393205 3:179474858-179474880 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 966393211 3:179474873-179474895 TCCCAAAGTGCTGGAATTACAGG 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966393205 Original CRISPR CTTTGGGAGGGCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr