ID: 966398036

View in Genome Browser
Species Human (GRCh38)
Location 3:179521716-179521738
Sequence CTACTTAGGCACTCTCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966398029_966398036 25 Left 966398029 3:179521668-179521690 CCCTCTTAAAGTAAATAAATAAT 0: 26
1: 20
2: 195
3: 3409
4: 5045
Right 966398036 3:179521716-179521738 CTACTTAGGCACTCTCTAATTGG No data
966398030_966398036 24 Left 966398030 3:179521669-179521691 CCTCTTAAAGTAAATAAATAATC 0: 26
1: 17
2: 5
3: 65
4: 639
Right 966398036 3:179521716-179521738 CTACTTAGGCACTCTCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966398036 Original CRISPR CTACTTAGGCACTCTCTAAT TGG Intergenic
No off target data available for this crispr