ID: 966402638

View in Genome Browser
Species Human (GRCh38)
Location 3:179563096-179563118
Sequence AGCGGCGGCGTGTACGGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966402631_966402638 -8 Left 966402631 3:179563081-179563103 CCGGCAGCAGCCATGAGCGGCGG 0: 1
1: 0
2: 2
3: 11
4: 147
Right 966402638 3:179563096-179563118 AGCGGCGGCGTGTACGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 134
966402627_966402638 12 Left 966402627 3:179563061-179563083 CCCTTAGGGTAGGAGTCGCGCCG 0: 1
1: 0
2: 0
3: 0
4: 12
Right 966402638 3:179563096-179563118 AGCGGCGGCGTGTACGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 134
966402628_966402638 11 Left 966402628 3:179563062-179563084 CCTTAGGGTAGGAGTCGCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 966402638 3:179563096-179563118 AGCGGCGGCGTGTACGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 134
966402626_966402638 20 Left 966402626 3:179563053-179563075 CCAGTTAGCCCTTAGGGTAGGAG 0: 1
1: 0
2: 1
3: 6
4: 65
Right 966402638 3:179563096-179563118 AGCGGCGGCGTGTACGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966402638 Original CRISPR AGCGGCGGCGTGTACGGGGG AGG Exonic
902286481 1:15411117-15411139 AGCTGCTGGGTGCACGGGGGTGG - Intronic
902329744 1:15725458-15725480 AGAGGTGGTGTGCACGGGGGTGG - Exonic
903446154 1:23424169-23424191 AGCGGCGGCGATGGCGGGGGCGG - Intronic
903542929 1:24107061-24107083 TGAGGCGGCGGGTAAGGGGGTGG - Exonic
903750217 1:25616809-25616831 GGCGGCGGCGGGGACGGCGGTGG + Intergenic
908128174 1:61050633-61050655 AGGGGCGGCGAGTGCGGGGCGGG - Intronic
912229995 1:107782330-107782352 AGAGGCGGTGTGTAGGGGAGGGG - Intronic
915070434 1:153261445-153261467 AGCGGCGGCTCCTCCGGGGGCGG + Exonic
922648571 1:227317949-227317971 ACCGGCGGCGCGGCCGGGGGTGG + Exonic
1064274191 10:13891761-13891783 GGCGGCGGCGGGGACGGGGCGGG - Intronic
1064410189 10:15097778-15097800 AGGGGCGGCGTGCAGTGGGGAGG + Intronic
1066963966 10:42243670-42243692 AGCGGCGGCGGGGGGGGGGGGGG - Intergenic
1067071876 10:43138453-43138475 CGCGGCGGCGCGCCCGGGGGTGG + Intergenic
1070780678 10:79135886-79135908 AGCGGCGGCGGGTGGGTGGGTGG - Intronic
1072278516 10:93845424-93845446 TACGGCGGCGGGTAGGGGGGAGG - Intergenic
1072731492 10:97849958-97849980 GGCGGCGGCGGGGATGGGGGCGG - Intergenic
1074136212 10:110628888-110628910 GGCGGGGGCGGGTAGGGGGGTGG - Intergenic
1077098436 11:810018-810040 CGCGGCGGCGTCTGCGGCGGAGG - Exonic
1077173085 11:1176977-1176999 ACCTGCGCCGTGTACGGGGACGG + Intronic
1083656989 11:64234579-64234601 AGCGGCGGCGGGGACGGCGGGGG - Exonic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084602805 11:70156175-70156197 TGCGGTGGCGGGGACGGGGGTGG + Intronic
1087152571 11:94871972-94871994 AGCAGAGGCGTGCGCGGGGGAGG - Exonic
1090344999 11:126062664-126062686 CGCGGCGGCGGCTACGGTGGCGG + Intronic
1093488864 12:19681954-19681976 AGTGGAGGTGTGTTCGGGGGTGG + Intronic
1094588675 12:31800984-31801006 AGGGGCGGCGGGGGCGGGGGCGG + Intergenic
1096396443 12:51270018-51270040 GGCGGGGGCGGGGACGGGGGCGG - Intronic
1101351128 12:103930592-103930614 AGCGGCCGCGTGTGTGGAGGGGG - Intronic
1105890706 13:24680668-24680690 AGCGGCGGAGCGCACGGTGGGGG - Exonic
1106483045 13:30150928-30150950 AGCGGCTGCGTGTGCTGGTGAGG - Intergenic
1110119346 13:71864682-71864704 AGCGGCGCTGTGAAAGGGGGTGG + Intronic
1111672466 13:91348068-91348090 GGCGGCGGCGTGGCCGGGGCGGG + Intergenic
1115474560 14:33800591-33800613 AACGGCGGCGGGGGCGGGGGCGG + Exonic
1123898069 15:24848241-24848263 GGCGGCGGCGGGGGCGGGGGCGG + Intronic
1124497513 15:30195659-30195681 AGGGGCGACGGGGACGGGGGCGG + Intergenic
1124922308 15:34038901-34038923 GGCGGCGGCGGGGACGGAGGCGG - Exonic
1130719367 15:86371868-86371890 AGTGGCTGCTTGTAGGGGGGAGG + Intronic
1131049049 15:89334509-89334531 GGCGGCGGGGCGCACGGGGGTGG - Intronic
1132560194 16:590042-590064 GGCGGCGGCGCGGCCGGGGGTGG + Intronic
1134149826 16:11797045-11797067 GGCGGCGGCGCGCGCGGGGGGGG + Intronic
1135517615 16:23148939-23148961 GGCGGCGGCGGGCACGGCGGCGG + Exonic
1135976121 16:27109859-27109881 GGCGGCGGCGGGACCGGGGGCGG + Intergenic
1137655303 16:50153745-50153767 AGCGGCGGCGCGAGCGGCGGCGG + Exonic
1139548386 16:67660335-67660357 AGGCGCGGGGTGTACGTGGGCGG - Exonic
1139683239 16:68581541-68581563 AGCGGGCGCCTGTACTGGGGAGG - Intergenic
1140407123 16:74718360-74718382 AGCAGCGGGGGGTACAGGGGAGG + Intronic
1142417204 16:89949177-89949199 AGCGGCGGCGTCCCCGGGGTGGG - Intronic
1144109810 17:12020908-12020930 GGCGGCGGCGGCTCCGGGGGCGG + Exonic
1144675451 17:17158701-17158723 AGCGGGAGCGTGCACGGAGGCGG + Exonic
1147486362 17:40818901-40818923 GGCGGCGGCGGCTACGGGGGCGG - Exonic
1147486387 17:40818988-40819010 TCCGGCGGCGGCTACGGGGGCGG - Exonic
1150423088 17:65056241-65056263 GGCGGCGGCGGGTGCGGGGCGGG - Intronic
1150488916 17:65561352-65561374 AGCCGCGGCGTGGGCGCGGGGGG - Intronic
1151783941 17:76265973-76265995 AGCGGCGGCGGGCAGGGGCGCGG + Intronic
1152104174 17:78319137-78319159 AGCGGGGGAGTGTGTGGGGGGGG + Intergenic
1152427276 17:80225168-80225190 AGCGGCGGGGGGTTGGGGGGTGG - Intronic
1152555740 17:81052366-81052388 AGAGGCCACGTGCACGGGGGTGG - Intronic
1161022205 19:2015709-2015731 GGCTGCGGCGTGGGCGGGGGAGG + Exonic
1161216687 19:3098282-3098304 GGCGGCGGCGCGGACGGAGGCGG - Intronic
1161383925 19:3981030-3981052 AGAGGAAGCGTGTACGGGGTGGG - Intronic
1162145529 19:8610726-8610748 CGCGGCGGCGTGGCCAGGGGAGG + Intronic
1162740223 19:12769869-12769891 AGCGGCGGCAGGTGCGGCGGGGG - Exonic
1162752725 19:12838688-12838710 AGCGGCGGCTTTTGCGGGGAGGG - Intronic
1162913390 19:13861929-13861951 ACCGGGGGTGTGTAGGGGGGAGG + Intergenic
1163282413 19:16325645-16325667 AGCGGCGGTGTGTCGGGCGGCGG - Exonic
1163585510 19:18161455-18161477 GGCGGCGGCGAGGACGGCGGCGG - Exonic
1165349621 19:35268876-35268898 AGCGGCGGCGGCTGCGGCGGCGG + Intergenic
1166107709 19:40605529-40605551 AGCGGCGGCGCGGGCGGAGGCGG + Exonic
1167266567 19:48485672-48485694 AGAGGCGGCGTCTGCGGTGGTGG + Exonic
1168293010 19:55366131-55366153 GGCGCCGGCGGGTCCGGGGGTGG + Exonic
1168336592 19:55600575-55600597 AGCGGCGCCGGGTAAGCGGGCGG - Intronic
1202683494 1_KI270712v1_random:30079-30101 GGCGGCGGCGGGTGGGGGGGGGG - Intergenic
929778330 2:44942198-44942220 AGCGGCGGCGGGAACGGTGCGGG + Exonic
929778345 2:44942246-44942268 AGCGGCGGCGGGAACGGTGCGGG + Exonic
931348830 2:61470820-61470842 GGCGGCGGCGGGGACGGGGCGGG + Intergenic
931517833 2:63059945-63059967 AGCGGCGGCGGGAACGCGGAAGG + Intergenic
937954868 2:127416438-127416460 AGCGGCTGCCTGTGCTGGGGTGG + Intergenic
941020929 2:160407543-160407565 GGCGGCGGCGGGTGCGGGCGCGG + Intronic
943185192 2:184598379-184598401 GGCGGCGGGGTGGGCGGGGGAGG + Exonic
944831206 2:203535304-203535326 GGCGGCGGCGGGAGCGGGGGCGG + Exonic
946747498 2:222860932-222860954 AGCGGTGGCGCGTGCGGGGCTGG - Exonic
1170150458 20:13221595-13221617 CGCGGCGGGGTGTGCGGGGCCGG - Intergenic
1171499923 20:25585503-25585525 AGCGGCCGGCGGTACGGGGGTGG - Exonic
1172284618 20:33732056-33732078 AGCGGCGGCGGGGCCGGCGGAGG + Intronic
1175878786 20:62244367-62244389 AGCGGCGGCGGGTCGGGGGCTGG + Intronic
1176061646 20:63175291-63175313 GGCGGCGGCGTGGGCGGCGGCGG + Intergenic
1176120798 20:63453699-63453721 GGAGGAGGCGTGTACAGGGGCGG + Intronic
1178487048 21:33025857-33025879 AGCGGTGGCGGGGGCGGGGGCGG - Intronic
1179717803 21:43298780-43298802 TGCGCCTGCGTGTACGGGGGCGG - Intergenic
1179976766 21:44872991-44873013 AGTGGCGGCGTGAACGCCGGCGG + Intronic
1180559047 22:16601355-16601377 GGCGGCGGCGCGTCCGCGGGCGG + Intergenic
1182729373 22:32474944-32474966 AGCGGCGACGGGGACGGCGGCGG - Exonic
1184642200 22:45878659-45878681 AGGGGCGGCGTGTGGGGGGCGGG - Intergenic
1185347522 22:50317006-50317028 GGGGGCGGCGAGGACGGGGGGGG + Intronic
953626900 3:44579268-44579290 AGCGGGAGCGTGCACGGAGGCGG - Intronic
953989881 3:47475832-47475854 GGCGGCGGCGGCGACGGGGGCGG + Exonic
954838953 3:53494710-53494732 AGCGGCGGCGCGGGCGGCGGCGG + Intronic
961827162 3:129605273-129605295 GGCGGCGGCGGGGGCGGGGGCGG - Intronic
961827625 3:129606981-129607003 GGCGGCGGCGGCTACGGGGAGGG - Intergenic
962259896 3:133895629-133895651 TGCGGCTGCGTGTCCGGCGGCGG + Exonic
966402638 3:179563096-179563118 AGCGGCGGCGTGTACGGGGGAGG + Exonic
970319706 4:14863051-14863073 TGGGGCGGCGCGTGCGGGGGCGG - Intergenic
971351929 4:25862960-25862982 GGCGGCGGCGGGTCCGGAGGTGG - Intronic
982291799 4:153789250-153789272 AGCGGCGGCATCTAGGGGAGGGG - Intergenic
988922229 5:35954123-35954145 AGGGGTGGCGTGTGCTGGGGTGG + Exonic
998044461 5:138975326-138975348 AGTGGTGGCGTGTCAGGGGGAGG - Intronic
1001687572 5:173605738-173605760 AGCGCCATCGTGTACGGTGGGGG - Intergenic
1002064901 5:176647199-176647221 GGCGGCGGCCTGCGCGGGGGCGG + Intergenic
1002368162 5:178729414-178729436 CGCAGCGGCGTGAACGGGGCAGG - Intronic
1002385163 5:178860634-178860656 CGCAGCGGCGTGAACGGGGCAGG + Intronic
1004193970 6:13487705-13487727 GGCGGCGGCGGGGGCGGGGGCGG - Intergenic
1006676264 6:35765859-35765881 AGGTGCGGCGTGTGCCGGGGAGG - Intergenic
1007967327 6:46015226-46015248 AGCGGAGGCGGGGACGGGGGTGG + Intronic
1011686712 6:89829677-89829699 AGGGGCGGGGTGTAAGGTGGCGG - Intergenic
1018876516 6:167826844-167826866 GGCGGCGGCGCGCACGGCGGCGG + Intergenic
1019916693 7:4137732-4137754 GACGGCGGCGTGTGCGAGGGAGG - Intronic
1020204519 7:6104835-6104857 GGCGGCGGCGCGTTCGGGCGCGG + Intergenic
1020274288 7:6615487-6615509 AGCGGCGGCGGCGACGGCGGCGG + Intergenic
1021451249 7:20785332-20785354 AGCGGCGGCGGCGGCGGGGGCGG - Exonic
1022091443 7:27110357-27110379 GGCGGCGGCGGGTGCAGGGGCGG + Exonic
1026765163 7:73155454-73155476 AGCGGCGGCGGGGGCGGGGCGGG - Intergenic
1027041636 7:74965209-74965231 AGCGGCGGCGGGGGCGGGGCGGG - Intronic
1027082006 7:75237160-75237182 AGCGGCGGCGGGGGCGGGGCGGG + Intergenic
1029390589 7:100271705-100271727 AGCGGCGGCGGGGGCGGGGCGGG + Intronic
1029453669 7:100656329-100656351 AGCGGGGGCGTCTACGGCGGAGG - Exonic
1032073740 7:128826267-128826289 AGCGGCGAGGGGTAGGGGGGCGG + Intergenic
1033306668 7:140230599-140230621 AGCGGCGGTGTGGACGCGCGAGG - Intergenic
1034483544 7:151341743-151341765 AGCGGCGGCGGGGGCGGGGCTGG + Exonic
1034618272 7:152436652-152436674 GGCGGCGGCGCGTCCGCGGGCGG - Intergenic
1035021380 7:155803066-155803088 AGCGGCGGCGGGGACCGCGGGGG - Exonic
1039885975 8:41654080-41654102 AGCGGCGGGGCGGACGGGGCCGG + Intronic
1041505866 8:58596839-58596861 AACGGCGGCGTGAACCCGGGAGG + Intronic
1048214130 8:132480474-132480496 GGCGGCGGCGGCGACGGGGGCGG - Exonic
1054781387 9:69169029-69169051 AGTGGGGGCGGGGACGGGGGAGG + Intronic
1056992265 9:91423491-91423513 AGCGGCGGCGAGTGCGCGCGGGG - Intronic
1060228989 9:121813422-121813444 AGCGGCGGGGGGTTGGGGGGTGG - Intergenic
1060481738 9:124020284-124020306 AGCGGCAGAGTGGACGGGGAAGG - Intronic
1061610037 9:131740020-131740042 AGCGGCGGCGGGCGCGCGGGAGG - Intronic
1062234464 9:135501249-135501271 AGCGGCGGCGAGCACGGGAGTGG - Intronic
1186466125 X:9786027-9786049 AGCGCGGGCGAGGACGGGGGCGG - Intronic
1200092949 X:153644281-153644303 GGCGGGGGCGGGTGCGGGGGCGG + Intronic