ID: 966409679

View in Genome Browser
Species Human (GRCh38)
Location 3:179635244-179635266
Sequence GTCTGTTACCTCTTCATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966409679_966409681 11 Left 966409679 3:179635244-179635266 CCTTTTATGAAGAGGTAACAGAC No data
Right 966409681 3:179635278-179635300 ACAGACCCTGTGAAGACAGAAGG No data
966409679_966409684 21 Left 966409679 3:179635244-179635266 CCTTTTATGAAGAGGTAACAGAC No data
Right 966409684 3:179635288-179635310 TGAAGACAGAAGGAGAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966409679 Original CRISPR GTCTGTTACCTCTTCATAAA AGG (reversed) Intergenic
No off target data available for this crispr