ID: 966411731

View in Genome Browser
Species Human (GRCh38)
Location 3:179652734-179652756
Sequence CCCAATCCTGCTCTTTGTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966411724_966411731 23 Left 966411724 3:179652688-179652710 CCGCCCTAGTCTTCGGCTGTTTT 0: 1
1: 0
2: 1
3: 6
4: 81
Right 966411731 3:179652734-179652756 CCCAATCCTGCTCTTTGTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 152
966411725_966411731 20 Left 966411725 3:179652691-179652713 CCCTAGTCTTCGGCTGTTTTAAA 0: 1
1: 0
2: 0
3: 11
4: 117
Right 966411731 3:179652734-179652756 CCCAATCCTGCTCTTTGTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 152
966411726_966411731 19 Left 966411726 3:179652692-179652714 CCTAGTCTTCGGCTGTTTTAAAA 0: 1
1: 0
2: 0
3: 17
4: 171
Right 966411731 3:179652734-179652756 CCCAATCCTGCTCTTTGTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966411731 Original CRISPR CCCAATCCTGCTCTTTGTGT TGG Exonic
904921818 1:34013963-34013985 CCCAAACCTGCTCTTCCTATGGG + Intronic
909689231 1:78388112-78388134 CTGAATCCTCCTCTTAGTGTTGG - Intronic
912238537 1:107880241-107880263 ACCACTCCTTCTCTTTATGTAGG - Intronic
915063213 1:153203603-153203625 CCCAACCCTGCTCAGTGCGTGGG - Intronic
922117390 1:222627287-222627309 CCCAATCCTGTTTTCTGTTTGGG - Intronic
922345093 1:224689925-224689947 CCCAAACCTGCACTTTGTAGGGG - Intronic
922786058 1:228282858-228282880 CCCAATCCTGGTCATGGTGGAGG + Intronic
1064536820 10:16365860-16365882 CCACATCCAGCTCTTTGTGTAGG + Intergenic
1065738362 10:28774265-28774287 CCCATCCCTGTCCTTTGTGTTGG - Intergenic
1065843854 10:29728804-29728826 CCCCAGCCTGCTCTTTGACTTGG - Intronic
1066384609 10:34931527-34931549 TCCAATCATGCCCTTTGGGTTGG - Intergenic
1068296645 10:55080029-55080051 AGCAGTCCTGCTATTTGTGTTGG + Intronic
1070674952 10:78406078-78406100 CCTAATCCTTCTCTTTGGGATGG + Intergenic
1070708241 10:78657227-78657249 CCCAATCCTGGGCTTTGTGCTGG - Intergenic
1072270847 10:93774715-93774737 CCCAGTTCTGTTTTTTGTGTAGG + Intronic
1072735466 10:97876093-97876115 CCCAATCCTGCTCTTGATCCTGG + Intronic
1073050656 10:100664962-100664984 CCTTACCCTGCTCTGTGTGTGGG + Intergenic
1076319138 10:129565139-129565161 CCGAAGCCTGCTCCTCGTGTGGG + Intronic
1076558141 10:131343690-131343712 ACCAATCTTGCTCTTTTTTTTGG + Intergenic
1083171825 11:60927754-60927776 GCCAATCCTGCCCTTTGAGGTGG - Exonic
1084471543 11:69362456-69362478 CCCAGTCCTGCTCTACCTGTTGG - Intronic
1085692629 11:78676184-78676206 CCCGAGCCTGCTCTTTGCGCTGG + Exonic
1088540948 11:110913056-110913078 CCAAATACTTTTCTTTGTGTTGG + Intergenic
1090245057 11:125210244-125210266 CTGAATTTTGCTCTTTGTGTCGG + Intronic
1092173527 12:6388103-6388125 CCCAATCCTGGTCTCTGAGCAGG + Intronic
1092282850 12:7110397-7110419 CCCAATCCTGATCTGAGTCTTGG - Intergenic
1093092644 12:14938529-14938551 TCCAACCCTGGACTTTGTGTTGG + Exonic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1097521147 12:60672499-60672521 TCCATTCCTCCTCATTGTGTGGG - Intergenic
1098420111 12:70286753-70286775 CTCAATACTTCTTTTTGTGTTGG - Intronic
1098445750 12:70564083-70564105 CCCACTCAAGGTCTTTGTGTTGG + Intronic
1099976493 12:89551062-89551084 CCAAGTCTTGCTCTTTGTGGTGG + Intergenic
1100814629 12:98374420-98374442 CCAAACCCTGCTCTTGGTGGTGG + Intergenic
1103441311 12:120965134-120965156 CTCCACCCTGCTCTGTGTGTGGG + Intergenic
1104258757 12:127163560-127163582 CCCAATGCTGCTGTTAGTGAGGG + Intergenic
1104389754 12:128381722-128381744 CTCAAAGCTGCTCTTTGTGGAGG - Intronic
1105668456 13:22586568-22586590 CCCATTCCTCCTCATTGGGTGGG - Intergenic
1112965910 13:105193300-105193322 CCCAAATCTGTACTTTGTGTAGG - Intergenic
1119704159 14:76773684-76773706 CCCACTTCTGCCCTTTGGGTTGG - Intronic
1121501707 14:94443273-94443295 GCCACTCCTGCTCTGTCTGTCGG + Intronic
1122535421 14:102458541-102458563 GCCACTCCTGGCCTTTGTGTTGG + Intronic
1128087206 15:64894554-64894576 CTAAATCCTGCTCATTGTTTAGG - Intronic
1128861478 15:71077781-71077803 CCCAGGCCTGCTCTGTGTGATGG + Intergenic
1130111704 15:80970802-80970824 CCCCATCCTGCTCCTTGGCTGGG - Intronic
1131834343 15:96375099-96375121 CTCAATCATGCTCTTTATATTGG + Intergenic
1133221976 16:4322771-4322793 CCCACTCCTGCTCTCGGAGTTGG + Intronic
1134264533 16:12681872-12681894 CCCAATTCTGCTCTTTGCCCTGG - Intronic
1134311647 16:13080581-13080603 CTCAATCCTGCTCTTCTTTTAGG - Intronic
1136026337 16:27471339-27471361 CCCAATCCTGCACTGGCTGTTGG + Intronic
1141030879 16:80587277-80587299 CCTACTTCTGCTCTTAGTGTAGG - Intergenic
1141127322 16:81409919-81409941 CCAAGCCCTGCTCTATGTGTTGG - Intergenic
1143996697 17:11012574-11012596 CGCAATTCTGCTCTTTCTGGTGG + Intergenic
1144960570 17:19042018-19042040 CCCAGCCCTGCTCTGTGAGTAGG - Intronic
1144974590 17:19132506-19132528 CCCAGCCCTGCTCTGTGAGTAGG + Intronic
1146286766 17:31579322-31579344 CCCAATCCTGCTAACTGGGTGGG - Intergenic
1152107242 17:78337795-78337817 CCCAACCCTACTCCCTGTGTGGG + Intergenic
1152378818 17:79931711-79931733 CCCCACCCTGCTCTTGGGGTGGG + Intergenic
1153789146 18:8561986-8562008 CGCTGTCCTGCTCTTTGTGCAGG - Intergenic
1154107178 18:11533357-11533379 CCCCAACCTGCTCTTGCTGTGGG - Intergenic
1154333315 18:13447350-13447372 CCCAGTCCCGCCCCTTGTGTTGG + Intronic
1156353637 18:36322517-36322539 CCCAAACCTGCTCTTTCTTTTGG - Intronic
1156762678 18:40612486-40612508 CCCAAACCTGTTCATTGTTTGGG - Intergenic
1160178373 18:76613966-76613988 CCCTGTCCTTCCCTTTGTGTCGG - Intergenic
1160681554 19:413724-413746 CCCAATCCCGTTCTCTGGGTTGG - Intergenic
1164952878 19:32353414-32353436 GCCCCTCCAGCTCTTTGTGTCGG + Exonic
1165401474 19:35603451-35603473 CCCTACCCTGCTCCTTGGGTAGG - Intergenic
1165409244 19:35648705-35648727 CCAAATCCTGGTCGCTGTGTAGG - Intronic
1165596341 19:37013616-37013638 CCCATTCCTGCTCAATGGGTGGG - Intronic
1165994394 19:39833774-39833796 CCCACTCCCGCCCTTTGTTTGGG - Intronic
1166110399 19:40619144-40619166 TTCAATCCTGTTCTTTGAGTAGG - Intronic
929111645 2:38409982-38410004 CCCTCTCTGGCTCTTTGTGTGGG - Intergenic
929458857 2:42086405-42086427 CCCAGTCCTGGGCTGTGTGTTGG - Intergenic
933452722 2:82477399-82477421 TTCAATCCTGCTCTCTGTCTTGG + Intergenic
934127300 2:88908836-88908858 CTCAATTTTGCTCTTTATGTTGG + Intergenic
934557145 2:95293476-95293498 CCCACTCCAGCCCTTAGTGTGGG - Intergenic
934743830 2:96745321-96745343 CCCAGCCCTGCTCTTTGGTTTGG - Intergenic
935267437 2:101406996-101407018 CCCAAGGCTGCTCTCTGTCTGGG - Intronic
936008589 2:108910596-108910618 CCCAACCCTGCTCTTCCTGTTGG + Intronic
939282050 2:140076296-140076318 CCGAATACTGCTCTTTCTGGTGG - Intergenic
939741091 2:145907302-145907324 ACCACTCCTGCTTTTTGTTTTGG - Intergenic
941060200 2:160838283-160838305 CAGAATCCATCTCTTTGTGTGGG + Intergenic
941982930 2:171479443-171479465 CCCAGTCCTGTTCTGTGGGTTGG + Intronic
942978792 2:182053144-182053166 ACCAATTCTGCTCTTAGAGTAGG + Intronic
944367872 2:198945580-198945602 TCCTATCCTGGTCATTGTGTTGG - Intergenic
944882231 2:204025310-204025332 CCCAATCCTTATCTTTGTCTGGG + Intergenic
945978671 2:216290811-216290833 CCCCATCCTTCTCATTGTGCAGG - Intronic
1169535052 20:6529479-6529501 TCCAGTCATACTCTTTGTGTTGG + Intergenic
1171323332 20:24266514-24266536 CCCCACCCTACTCCTTGTGTGGG - Intergenic
1175550172 20:59812425-59812447 CCCACTCCTGCTCTGTCTGCAGG + Intronic
1179217275 21:39378383-39378405 CAGACTCCTGCTCTTTGTTTTGG + Intergenic
1179590600 21:42405578-42405600 CCGAATGCTGCTATTTGGGTGGG - Intronic
1181649379 22:24250314-24250336 CCCAAACCTGCCCTTTCTGCAGG - Intergenic
1182585935 22:31344436-31344458 CCTACTCCTGCCCTGTGTGTGGG - Exonic
1183605332 22:38864510-38864532 CCCTACCCTGCCCTGTGTGTTGG - Exonic
1185372844 22:50468903-50468925 CTCAAACCTGCTGTCTGTGTGGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951465677 3:22998235-22998257 CCCACTTCTGATCTTTCTGTAGG + Intergenic
954795747 3:53160815-53160837 CCCACTCCTGCTCTTCCTGTTGG - Intronic
963280871 3:143383817-143383839 CCCAGTCCTGCTGTTGGGGTGGG + Intronic
963930376 3:150998434-150998456 CCCAATCCAGCTCTCAGTGAAGG - Intergenic
966411731 3:179652734-179652756 CCCAATCCTGCTCTTTGTGTTGG + Exonic
975106245 4:70571911-70571933 CCCATTCCTACTCTGTGGGTGGG - Intergenic
981184497 4:141784921-141784943 CCCATTCCTGATCTTTTTCTGGG + Intergenic
982137134 4:152282431-152282453 CACAATGCTGATCGTTGTGTAGG - Intergenic
982756771 4:159229320-159229342 CCTAATCTTGCCCTTTGTATGGG - Intronic
984827597 4:183940528-183940550 CACAATCCTGCTTTTTATCTTGG + Intronic
986103267 5:4633440-4633462 CCCATTCCAGCTCTTGGTGGAGG + Intergenic
988293872 5:29329637-29329659 TAAAGTCCTGCTCTTTGTGTAGG + Intergenic
992763261 5:79970634-79970656 CCCAATCCAGCCCTTTGCTTGGG - Intergenic
992819261 5:80479529-80479551 CCAAATCCTACTCTTTCTCTTGG - Intergenic
993135227 5:83952478-83952500 CCCAATTCTACTTTTTCTGTGGG - Intronic
995817639 5:116189963-116189985 CCCTTTCCTGCTCTTAGAGTAGG + Intronic
996800596 5:127398478-127398500 CCCAGTCCTTCCCTTTGTTTTGG - Intronic
999761126 5:154702004-154702026 CTCAATCCTGCTGTGTCTGTGGG - Intergenic
1000066297 5:157695537-157695559 CCCAATCCCACTCTTTATCTGGG - Intergenic
1000154045 5:158533384-158533406 CCAAATCCTGCTCTTTATGGAGG - Intergenic
1001691059 5:173632753-173632775 CTCAATCTTGCTCATTATGTGGG + Intergenic
1002138977 5:177127070-177127092 CCCAATCCTGCTCCTTCTCTAGG - Intergenic
1003229582 6:4240028-4240050 CCCAATCCTGCTGGTTGTTATGG + Intergenic
1003389753 6:5703614-5703636 CCCAAATCTGGTCTGTGTGTGGG - Intronic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1004035472 6:11918924-11918946 TCCAAACCTGCTCTGTGTTTAGG - Intergenic
1004233912 6:13856692-13856714 CCCAGTCCTTCTCTTGCTGTTGG + Intergenic
1004772520 6:18800315-18800337 CCCACTTCTCCTCTTTTTGTTGG + Intergenic
1005831338 6:29673316-29673338 CCCATTCATGCTCTGTGTGTGGG - Exonic
1007183842 6:39950695-39950717 CTCAATCATGCTGTTTGGGTGGG - Intergenic
1007215586 6:40234975-40234997 CCCATTCCTCCTCATTGGGTGGG + Intergenic
1011132155 6:84062981-84063003 CCCAAACTTACTCTTGGTGTGGG - Exonic
1013639707 6:112061221-112061243 CACAATACAGCCCTTTGTGTGGG - Exonic
1015287024 6:131497492-131497514 CCCCATCTTGCTCTTTTTATGGG + Intergenic
1016374480 6:143406458-143406480 TCCAATCCTGCTTTCTTTGTGGG + Intergenic
1018427985 6:163700447-163700469 CCCAATTCTTCTCTGTGTGCAGG - Intergenic
1018439562 6:163797753-163797775 CACAACCCTTCTCTTAGTGTTGG + Intergenic
1020371150 7:7433192-7433214 CCCCTCCCTGCTCTTTCTGTAGG - Intronic
1022759915 7:33337256-33337278 ACCAATCCTGCAGTTTGAGTTGG + Intronic
1023816560 7:43954956-43954978 CCCAAGCCTGCTCTCTCTGTTGG + Exonic
1023894129 7:44418048-44418070 CCTAAACCTGCCCTGTGTGTAGG - Intronic
1026911782 7:74095298-74095320 CCCTAGCCTGTTCTCTGTGTGGG + Intronic
1028155082 7:87420577-87420599 ACCAAACCTGCCCGTTGTGTGGG + Intronic
1028732732 7:94170629-94170651 AACAATCATTCTCTTTGTGTTGG + Intergenic
1036223259 8:6938679-6938701 CCAAATCCTCATCTGTGTGTGGG - Intergenic
1036228489 8:6980456-6980478 CCAAATCCTCCTCTGTGTGCAGG - Intergenic
1036230941 8:6999566-6999588 CCAAATCCTCCTCTGTGTGTAGG - Intronic
1036233386 8:7018665-7018687 CCAAATCCTCCTCTGTGTGCAGG - Intergenic
1039006805 8:33047579-33047601 GCCATTCCTGCTCTTTTTGATGG - Intergenic
1039951846 8:42179219-42179241 CGGAATCCTGCTGTTTTTGTGGG - Intronic
1041612495 8:59868449-59868471 CTGAATCCTCCTCTTTGTCTAGG - Intergenic
1043507540 8:80917201-80917223 CCCAAACCTCCTCAATGTGTAGG - Intergenic
1045963592 8:107998209-107998231 CTCAATCCTGCTCCTTCTATGGG - Intronic
1049062971 8:140290500-140290522 CCCATTTCTGTGCTTTGTGTAGG - Intronic
1054744776 9:68843500-68843522 TCCAATCATGCTTATTGTGTAGG + Intronic
1055930965 9:81559624-81559646 CGCAAGCCTCCTCTTTGTGTTGG - Intergenic
1056474375 9:86939286-86939308 CCCAATCTTTCTCATTGTGTAGG + Intergenic
1058604447 9:106705726-106705748 CCCTTTCCTCCTCTCTGTGTGGG + Intergenic
1058712298 9:107690777-107690799 CCCAAACCTGCTCTTCCTCTTGG - Intergenic
1059220255 9:112609051-112609073 CCAAATCCTCCTCCTTCTGTTGG - Intronic
1060144293 9:121238022-121238044 CCCTAGCCTCATCTTTGTGTTGG - Intronic
1061810758 9:133161796-133161818 CCTCACCCTGCTGTTTGTGTGGG - Intronic
1186593174 X:10952916-10952938 CTCCATACAGCTCTTTGTGTTGG - Intergenic
1187471294 X:19571443-19571465 CTCCATCCTGCCCTTTCTGTTGG - Intronic
1190469553 X:50764513-50764535 CCCAACCCAGCTCTTTGTCGTGG - Intronic
1192261824 X:69510273-69510295 CCCACCCCCTCTCTTTGTGTGGG - Intronic
1193597162 X:83461050-83461072 CCCAATCCTGCACATTGCATGGG - Intergenic
1197307898 X:124865836-124865858 GCAAATCCTGCTCTTTTTTTTGG - Intronic
1199478722 X:148274177-148274199 TCCATTCCTGCTCACTGTGTGGG + Intergenic
1200321752 X:155196804-155196826 CCCAACCCTCCTCATTGGGTGGG - Intergenic