ID: 966412611

View in Genome Browser
Species Human (GRCh38)
Location 3:179658659-179658681
Sequence TACCCAAGGAGTCCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966412611_966412616 22 Left 966412611 3:179658659-179658681 CCTCACTGGGGACTCCTTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 966412616 3:179658704-179658726 TGTCCACTTGAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 159
966412611_966412615 21 Left 966412611 3:179658659-179658681 CCTCACTGGGGACTCCTTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 966412615 3:179658703-179658725 TTGTCCACTTGAGATGGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
966412611_966412614 15 Left 966412611 3:179658659-179658681 CCTCACTGGGGACTCCTTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 966412614 3:179658697-179658719 TCAGAATTGTCCACTTGAGATGG 0: 1
1: 0
2: 3
3: 13
4: 196
966412611_966412617 23 Left 966412611 3:179658659-179658681 CCTCACTGGGGACTCCTTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 966412617 3:179658705-179658727 GTCCACTTGAGATGGAGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966412611 Original CRISPR TACCCAAGGAGTCCCCAGTG AGG (reversed) Intronic
900628422 1:3620621-3620643 CACACACGGAGTCCCCACTGGGG + Intergenic
904865908 1:33578725-33578747 TGCCCTAGGAGTCCCTGGTGGGG + Intronic
905170773 1:36108408-36108430 TTCCCAAGGGGTCACCAGAGAGG - Intronic
905363624 1:37436803-37436825 TACTCAAGGAGCTCCCAGTCTGG + Intergenic
909376794 1:74950539-74950561 CACCCACACAGTCCCCAGTGGGG + Intergenic
913328607 1:117649344-117649366 TACCCAAGAAGCCTCCAGAGAGG - Intergenic
915516473 1:156415712-156415734 TACCCAGAGGGTCCCCAGGGAGG + Intronic
922097912 1:222458305-222458327 TCCACAAAGAGTCCCCACTGGGG + Intergenic
923018983 1:230148367-230148389 TAGAAAAGGAGTCCACAGTGAGG - Intronic
923172386 1:231429607-231429629 TTCCCACAGAGTCCCCACTGGGG - Intergenic
1062972877 10:1662025-1662047 GAGCCCAGGAGTCCCCAGGGAGG + Intronic
1067131583 10:43570171-43570193 TACCCAACTTGTCACCAGTGGGG + Intronic
1069822569 10:71236668-71236690 GAGCCAGGGAGTCTCCAGTGGGG - Intronic
1070570954 10:77638744-77638766 TCCCCAAAGAGCCCCCAGTGGGG + Intergenic
1076873887 10:133206589-133206611 AGGCCAAGGAGGCCCCAGTGGGG + Intronic
1077026636 11:442588-442610 ACTCCAAGGATTCCCCAGTGGGG - Intergenic
1077173513 11:1178730-1178752 GACCCAAGGAGCCCCCAGAAGGG + Intronic
1078357713 11:10644822-10644844 TTCCCAAGGAGTTTCCAGGGAGG + Intronic
1079759454 11:24310531-24310553 TACACACAGAGTCCCCACTGGGG + Intergenic
1081667827 11:44926860-44926882 GACCCAAGGGGCCCCCACTGTGG + Intronic
1083774479 11:64887831-64887853 TACCCAAGGTGGCCCTGGTGGGG - Intronic
1084569231 11:69949517-69949539 TCACCAAGAAGTCCCCGGTGGGG - Intergenic
1084961935 11:72721426-72721448 TCCCCAACGAATCCCCAGAGGGG + Intronic
1085765596 11:79279135-79279157 CAGCCAAGGAGTCCCTAATGTGG - Intronic
1091768276 12:3136021-3136043 TCCCCGAGGAGTCCCCAGCTTGG + Intronic
1092662170 12:10750281-10750303 TACCCAAGAAATCCACAGGGTGG - Intergenic
1097707095 12:62879594-62879616 TACCCCAACAGGCCCCAGTGTGG - Intronic
1098682374 12:73372650-73372672 TACTCAAAGAGTGCCCATTGGGG - Intergenic
1099105038 12:78486553-78486575 CACCCACAGAGTCCCCACTGGGG - Intergenic
1099189817 12:79550775-79550797 TACCTAAGAAGTTCCCTGTGTGG - Intergenic
1099467025 12:83000698-83000720 TCCCCATAGAGTCCCCACTGGGG - Intronic
1102260394 12:111439863-111439885 TTCACAAGGAGCCCCCAGTGAGG - Intronic
1102418680 12:112786886-112786908 TAACCAAGGTGTCAGCAGTGGGG + Intronic
1102977740 12:117218631-117218653 TGCCCACGGAGTCTCCACTGTGG - Intronic
1104115967 12:125749202-125749224 TTCACACAGAGTCCCCAGTGGGG + Intergenic
1104724911 12:131070129-131070151 GACCCAAGGGGTGCCCAGGGAGG - Intronic
1108773035 13:53728848-53728870 TACACGAGGACTCTCCAGTGAGG + Intergenic
1110514149 13:76389059-76389081 TACCCAAGGATTCTCCAAGGAGG + Intergenic
1122419582 14:101567025-101567047 AAAGCAAGGAGTCCTCAGTGCGG + Intergenic
1122815458 14:104310004-104310026 TAACAAGGGAGGCCCCAGTGGGG - Intergenic
1123113515 14:105883621-105883643 GAGCCACGGAGCCCCCAGTGTGG - Intergenic
1126101851 15:45122760-45122782 TAAGGAAGGAGACCCCAGTGCGG - Intronic
1132029875 15:98430696-98430718 AAAGCCAGGAGTCCCCAGTGGGG + Intergenic
1132602182 16:778281-778303 TCCCCACTGTGTCCCCAGTGAGG - Intronic
1132861600 16:2074463-2074485 TCCCCAAGGAGTCCTGAGAGAGG - Intronic
1132904887 16:2277556-2277578 TGCCCCATGAGTGCCCAGTGGGG + Intronic
1137023436 16:35452143-35452165 TTCCCCAGGTGTCCCCAGAGGGG + Intergenic
1138396014 16:56705391-56705413 TGCACAAGGAGCCCCAAGTGGGG + Intronic
1139205247 16:65022781-65022803 TACCCAAGTACTGGCCAGTGAGG + Intronic
1140770718 16:78201654-78201676 AATCCAAGGAATGCCCAGTGAGG - Intronic
1144342033 17:14318081-14318103 TACCCAAGGAGGCAGCAGGGAGG - Intronic
1147791106 17:43014815-43014837 TACCCAGGAAGTCCCCATTTTGG + Exonic
1148983424 17:51599396-51599418 CCCACAAAGAGTCCCCAGTGGGG + Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151659025 17:75509013-75509035 CACCCATGGAGATCCCAGTGGGG - Intronic
1153739296 18:8106165-8106187 GCCCCCAGGAGTCCCCAGAGTGG - Intronic
1155087608 18:22473220-22473242 AACCAAAAAAGTCCCCAGTGTGG + Intergenic
1155242547 18:23877405-23877427 TAACCAGGGCCTCCCCAGTGAGG + Intronic
1161044294 19:2126873-2126895 TACCCAAGGGGACTCCAGAGTGG + Intronic
1163232395 19:16013603-16013625 CACCGAAGGACTCCCCAGTGGGG + Intergenic
1163432847 19:17278608-17278630 CCCCCAAAGAGTCCCCAGTGTGG - Intronic
1163638420 19:18448596-18448618 TACCCACGGAGTCCACTGCGTGG - Intronic
1165226262 19:34357388-34357410 TATCCAAGGAGCCCCCAGGTGGG - Intergenic
1166948690 19:46412574-46412596 AGCCCAAGGAGCCCCGAGTGAGG - Exonic
1167377518 19:49119755-49119777 TCGCCAAGGGGTCCCCAGGGTGG - Intronic
925364165 2:3299981-3300003 GACCCTAAGATTCCCCAGTGAGG + Intronic
926807105 2:16721269-16721291 TAGCCAAGCTGTGCCCAGTGGGG - Intergenic
929053160 2:37855047-37855069 TCCCCAAGGAGCTCACAGTGGGG - Intergenic
929116231 2:38446647-38446669 TACCCCAGGAGGCCACAGAGAGG - Intergenic
929322435 2:40560806-40560828 AACCCAAGGAGGCACTAGTGAGG - Intronic
931176696 2:59861557-59861579 CCCACAAAGAGTCCCCAGTGGGG - Intergenic
931529684 2:63199751-63199773 GACCCACAGAGTCCCCACTGGGG + Intronic
932689498 2:73900257-73900279 TACCCTGGGAGGACCCAGTGGGG - Intronic
936379158 2:111968890-111968912 AACCCAGGCACTCCCCAGTGTGG + Intronic
937310530 2:120900046-120900068 TTCCCCAGCAGTTCCCAGTGTGG - Intronic
938098103 2:128476173-128476195 TCCCCAGTGTGTCCCCAGTGTGG + Intergenic
946254134 2:218430859-218430881 CACCCACGGAGCCCACAGTGTGG - Exonic
1170463233 20:16598941-16598963 TACTAAAGGAGTCCCCAGGCCGG + Intergenic
1170683216 20:18545226-18545248 CCCCCAAGGAGTCCACAGTTAGG + Intronic
1170732405 20:18986426-18986448 TACCCTTGGAGTCCACAGAGGGG - Intergenic
1170741849 20:19065321-19065343 TCCACATGGAGTCCCCACTGGGG + Intergenic
1172576278 20:36011193-36011215 TCCCCAAGGAGGCTGCAGTGGGG + Exonic
1173740866 20:45400870-45400892 TACACACAGAGTCCCCACTGGGG + Intronic
1174130693 20:48341646-48341668 TGGCTAAGGAGTCCCCTGTGTGG - Intergenic
1174391357 20:50220198-50220220 CACCCAAGGGCTCCCCAGGGAGG - Intergenic
1175987374 20:62770725-62770747 TCCCCACAGAGTCCCCAGGGAGG + Intergenic
1176234312 20:64047249-64047271 TGCCCAAGGACTGCCCAGTACGG - Intronic
1177773613 21:25544402-25544424 TGCACATGGAGTCCCCATTGGGG - Intergenic
1182246280 22:28960408-28960430 TTCCCAATCAGTCCCCACTGGGG + Intronic
1182507657 22:30796263-30796285 TAACCAAGGGGCCCTCAGTGAGG - Intronic
1182709713 22:32312861-32312883 TCCCCAGTGAGTCCCCATTGAGG - Intergenic
950810622 3:15646931-15646953 GGCCCAAGGTCTCCCCAGTGAGG - Intergenic
952404130 3:32990588-32990610 GTCCCAAGAAGTGCCCAGTGAGG - Intergenic
953972756 3:47359851-47359873 CACACACAGAGTCCCCAGTGGGG + Intergenic
961463690 3:127068781-127068803 CACCCCAGGAAGCCCCAGTGAGG - Intergenic
962658263 3:137571647-137571669 TACCCAAGAAGTGCACAGAGAGG + Intergenic
963007200 3:140737456-140737478 TCCCCAGGGATTGCCCAGTGGGG + Intergenic
963016704 3:140830658-140830680 TAGGCAAGGTGTCCCCAGAGGGG + Intergenic
966412611 3:179658659-179658681 TACCCAAGGAGTCCCCAGTGAGG - Intronic
967073621 3:185983069-185983091 CCCCCCAGCAGTCCCCAGTGAGG - Intergenic
969365567 4:6692355-6692377 TCCCCAAGGGGTCACCAGTGGGG + Intergenic
971969588 4:33604491-33604513 TCCACACAGAGTCCCCAGTGTGG - Intergenic
972897771 4:43644494-43644516 TCCTCAAAGAGTCCCCACTGGGG - Intergenic
974457420 4:62145877-62145899 AGCCCACAGAGTCCCCAGTGGGG + Intergenic
975609900 4:76193378-76193400 TCCACAAAGAGTCCCCACTGAGG + Intronic
978857334 4:113408234-113408256 CACCGAAGGATTTCCCAGTGGGG - Intergenic
979180596 4:117721704-117721726 TCCCCACAGAGTCCCCACTGGGG + Intergenic
981327827 4:143471794-143471816 TACATAAGCAGTCTCCAGTGTGG + Exonic
983520044 4:168698659-168698681 TACCCACTGAGTGCCCCGTGGGG + Intronic
988927801 5:36006823-36006845 TCCACACGGAGTCCCCACTGGGG - Intergenic
995120644 5:108532371-108532393 CCCCCACAGAGTCCCCAGTGGGG - Intergenic
998570077 5:143249185-143249207 TCCACCAGGAATCCCCAGTGGGG - Intergenic
1000751355 5:165099756-165099778 CCCACAAGGAGTCCCCACTGGGG - Intergenic
1004510276 6:16279043-16279065 TGCCCACGGATTCCACAGTGAGG + Intronic
1007139933 6:39561800-39561822 TACCCAGGGAGTCCCCAGACAGG + Intronic
1010611896 6:77963229-77963251 TCCACACAGAGTCCCCAGTGGGG + Intergenic
1011504638 6:88028245-88028267 TCCCCACACAGTCCCCAGTGAGG - Intergenic
1012771111 6:103436478-103436500 CACACAAAGAGTCCCCACTGGGG - Intergenic
1015039880 6:128703856-128703878 TCCACACAGAGTCCCCAGTGGGG + Intergenic
1015667514 6:135648445-135648467 CCCCCACAGAGTCCCCAGTGGGG - Intergenic
1022041605 7:26587101-26587123 TTGCCAAGGGGACCCCAGTGGGG - Intergenic
1022568053 7:31423142-31423164 TACCCCAGGAGTCCACAGCTAGG - Intergenic
1032425007 7:131815531-131815553 CCCCCATGGAGTCACCAGTGGGG - Intergenic
1032718389 7:134530404-134530426 TGGCAAAGGAGACCCCAGTGAGG + Intronic
1033423740 7:141224878-141224900 TATCCAAGAAGTGCCCAATGTGG - Intronic
1035591826 8:822174-822196 TACCTGAGCAGTCCCCATTGTGG - Intergenic
1043794490 8:84519431-84519453 AACCCAAGGAGTCTACAATGAGG - Intronic
1044188467 8:89284059-89284081 TCCACACGGAGTCCCCACTGGGG + Intergenic
1045418960 8:101995127-101995149 TTCTCAAGAAGTCCCCAGTCTGG - Intronic
1047341527 8:123985110-123985132 TTCTCAAGGAGTCCACAGTCTGG - Intronic
1049605501 8:143527342-143527364 AGCCCAAGCTGTCCCCAGTGTGG + Intronic
1054887557 9:70215151-70215173 CAGCAAAGGAGTCACCAGTGAGG + Intronic
1057233317 9:93338716-93338738 CCCCCAAAGAGTCCCCACTGGGG + Intronic
1059682489 9:116599682-116599704 TACACAAGGTGCCCCTAGTGGGG + Intronic
1059871880 9:118586999-118587021 TCCCCACAGAGTCCCCACTGGGG + Intergenic
1060570937 9:124639620-124639642 TAGCAAAGGAGTAGCCAGTGAGG + Intronic
1060767067 9:126302792-126302814 TACACAAGGAGACCTCTGTGAGG + Intergenic
1192436025 X:71144473-71144495 TACCCAAGCAGCAACCAGTGGGG - Intergenic
1200696730 Y:6367553-6367575 TACACAAGCAGTCCACACTGTGG - Intergenic
1201037383 Y:9797146-9797168 TACACAAGCAGTCCACACTGTGG + Intergenic