ID: 966427366

View in Genome Browser
Species Human (GRCh38)
Location 3:179793774-179793796
Sequence CTTCATTTCCAGATGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966427359_966427366 1 Left 966427359 3:179793750-179793772 CCCCCTTTCAAAGAACTCCAGTT 0: 1
1: 0
2: 2
3: 22
4: 179
Right 966427366 3:179793774-179793796 CTTCATTTCCAGATGGCTCAGGG 0: 1
1: 0
2: 1
3: 20
4: 252
966427362_966427366 -2 Left 966427362 3:179793753-179793775 CCTTTCAAAGAACTCCAGTTGCT 0: 1
1: 0
2: 1
3: 13
4: 251
Right 966427366 3:179793774-179793796 CTTCATTTCCAGATGGCTCAGGG 0: 1
1: 0
2: 1
3: 20
4: 252
966427360_966427366 0 Left 966427360 3:179793751-179793773 CCCCTTTCAAAGAACTCCAGTTG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 966427366 3:179793774-179793796 CTTCATTTCCAGATGGCTCAGGG 0: 1
1: 0
2: 1
3: 20
4: 252
966427361_966427366 -1 Left 966427361 3:179793752-179793774 CCCTTTCAAAGAACTCCAGTTGC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 966427366 3:179793774-179793796 CTTCATTTCCAGATGGCTCAGGG 0: 1
1: 0
2: 1
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966427366 Original CRISPR CTTCATTTCCAGATGGCTCA GGG Intergenic
900495743 1:2975248-2975270 CTTAATTTCCAGGTGTCCCAAGG - Intergenic
901508843 1:9704274-9704296 CTTCATTTCCAGAGTGCTAAGGG + Intronic
901510165 1:9714376-9714398 CTTCATTTACATATCACTCAGGG - Intronic
903130587 1:21277114-21277136 CTGCTTTCCCAGGTGGCTCAGGG + Intronic
904371470 1:30050194-30050216 TTTTATTTGCATATGGCTCAGGG - Intergenic
906574366 1:46874679-46874701 CTTCCTTTCCATATGACCCAGGG - Intergenic
906597605 1:47093225-47093247 CTTCCTTTCCATATGACCCAGGG + Intronic
907254877 1:53171508-53171530 CTTCACTTCCAGGAGGCGCAGGG - Intergenic
907309324 1:53530234-53530256 CCTCGTTTCCAGATGGCCCTGGG - Intronic
907478274 1:54722678-54722700 TTTCAGTTCCAGATGGCATAAGG - Exonic
908434134 1:64088503-64088525 TTTCATTTCCAGATCTTTCATGG - Intronic
908539700 1:65111077-65111099 ATTCATTTCCAGATGAGACATGG - Intergenic
908630262 1:66097608-66097630 CTAAATTTCCAGTTGGCTCTTGG + Intronic
908961327 1:69699910-69699932 ATTTATTTCCAGCTGGCTGAGGG + Intronic
910702289 1:90089340-90089362 GTTCATTTCCATATTGCCCATGG - Intergenic
911131065 1:94389032-94389054 TTACATTTCCATTTGGCTCATGG + Intergenic
912081320 1:105940674-105940696 ATTCAACCCCAGATGGCTCAAGG - Intergenic
912609533 1:111029135-111029157 CTTCCTTTCCATATGACCCAGGG - Intergenic
915305047 1:154972461-154972483 CTTCATTTCCAGCCAGCTCTCGG + Intronic
916498674 1:165367994-165368016 CTGCTTTGCCAGGTGGCTCATGG + Intergenic
916585904 1:166149934-166149956 CTTCTCTTCCAGGTGGCTCTAGG - Intronic
917207262 1:172590233-172590255 CTTGATTCCCAGAGGGCTCATGG + Intronic
919612045 1:199757641-199757663 CATCATTTCAAGATGGCACAAGG + Intergenic
920548297 1:206837060-206837082 CTTCATGTCTAAATGGCTCTGGG + Intronic
923180372 1:231512290-231512312 CTTCATTTGCAGAGGTCACATGG + Intergenic
923253213 1:232196411-232196433 CATCATTTCCACTTCGCTCATGG - Intergenic
1063049538 10:2431948-2431970 ATTCATTTCCAGATGGAACCTGG - Intergenic
1063079468 10:2751774-2751796 CTTGATTTCCAGATGGTGAATGG - Intergenic
1063132073 10:3186994-3187016 AGTCATTTCCAGGTGGCTGAGGG - Intergenic
1063132742 10:3192636-3192658 AGTCATTTCCAGGTGGCTGAGGG + Intergenic
1064270218 10:13858768-13858790 CTTCATCCCCAGCTGGATCAAGG + Intronic
1064665863 10:17650702-17650724 GTTATTTTCCAGATGGCTGATGG + Intronic
1065293707 10:24255478-24255500 CTTCATGTCCAGATGTGGCATGG - Intronic
1067338903 10:45385188-45385210 CCTCATTTCCAGGTTGTTCAAGG - Intronic
1068074985 10:52241589-52241611 CTTCATGTACAGAAGGCTTAGGG - Intronic
1068400158 10:56518179-56518201 TTACAGTTCCACATGGCTCAGGG + Intergenic
1070403167 10:76071116-76071138 CTTCATTTCCAGATTCGCCAAGG - Intronic
1071083829 10:81844582-81844604 TTTGTTTTCCATATGGCTCAAGG + Intergenic
1071168525 10:82834944-82834966 CTTCATTTCCAGATGTGTTAAGG + Intronic
1072124104 10:92430336-92430358 ATTCATTTCCAGCTGCCTCCTGG - Intergenic
1075869833 10:125763133-125763155 CTTCTTTTACATATTGCTCATGG - Intronic
1076270609 10:129149272-129149294 CTTCATGTCCATGTGTCTCAGGG + Intergenic
1076946485 10:133655166-133655188 TTTTTTTTCCAGTTGGCTCAGGG + Intergenic
1077431643 11:2518619-2518641 TTTAATCTCCAGATGGCTCCTGG + Intronic
1078466164 11:11552163-11552185 CTGCATTTCCAGAGGGCCTATGG - Intronic
1078490555 11:11764123-11764145 CCTCATCTCCAAAGGGCTCATGG - Intergenic
1078602973 11:12749587-12749609 CTTCACTTCCCCATGGCCCAGGG - Intronic
1079566067 11:21884661-21884683 TTTCATTTTCAGATTGTTCATGG - Intergenic
1080397434 11:31903009-31903031 CTGCATTTCCACAAGGCTCCAGG + Intronic
1080493275 11:32791141-32791163 CTTAATTTCCTGATGACCCATGG - Intronic
1081361605 11:42187040-42187062 CCTGAATTCCAGATGGCACATGG + Intergenic
1083653814 11:64219606-64219628 CTTCACCTCCAGGTTGCTCAGGG - Exonic
1084040997 11:66542705-66542727 CTTGATTTCCACAGGGCCCAGGG + Intronic
1084363772 11:68684912-68684934 CTTCCCTTCCAGATGGCCCGAGG + Exonic
1084893755 11:72250579-72250601 CTTCCTTTCCAGACGGCACAGGG - Intergenic
1087587521 11:100141109-100141131 CTTCATTTCCATAGGGCACGTGG + Intronic
1088777895 11:113103798-113103820 CTTCATTTGCATATCGCCCACGG - Intronic
1091145724 11:133278260-133278282 CTTCATTTCCAGCTGTCTTTGGG - Intronic
1091871609 12:3895905-3895927 CTTCTTTTCCATATGGCAGAAGG + Intergenic
1092651392 12:10639114-10639136 TTTTTTTTCCAGATAGCTCAAGG - Intronic
1092771119 12:11897634-11897656 ATTCATAACCAGATGCCTCATGG + Intergenic
1092784878 12:12017884-12017906 CTTTGGTTCCAGAGGGCTCAGGG - Intergenic
1093113004 12:15175440-15175462 CTTCATTTCCTGCTTGCACAGGG + Intronic
1096084037 12:48853170-48853192 CTTCAATTCCACATGGCTGTAGG + Intergenic
1099167968 12:79329823-79329845 CTCCGTTTCCATATGGCTGAAGG - Intronic
1099257394 12:80330833-80330855 TTTCATTTTCAGATTGTTCATGG - Intronic
1101021938 12:100561430-100561452 CTTCATTTCTAAATGGGCCAGGG - Intronic
1101452883 12:104796427-104796449 ATTCATTTCCATATGGCCTATGG - Intergenic
1102419164 12:112790461-112790483 CTTCCCATCCAGATGGCCCAGGG - Intronic
1103197157 12:119054693-119054715 CTTCAGTTCCAGATAGATCCAGG + Intronic
1103891042 12:124239378-124239400 TTTCACTTCTAGATGGCTCATGG - Intronic
1103978566 12:124720608-124720630 CTTGGGTTGCAGATGGCTCACGG - Intergenic
1104734755 12:131129953-131129975 TTTCAATTGCAGATGGCTGATGG - Intronic
1104960237 12:132485128-132485150 TTTCATCGCCAGATGGCTCTGGG - Intergenic
1107437680 13:40394657-40394679 CTTCATTTCCAGCAGGCACTGGG - Intergenic
1108484945 13:50914219-50914241 CTTCTTTACCTAATGGCTCATGG + Intronic
1110042890 13:70787748-70787770 GTTCATTTCCAGTTGGAACACGG + Intergenic
1112449621 13:99497001-99497023 TTTCCTTTCCAAATGGCTCTAGG + Intergenic
1112739382 13:102456207-102456229 CATCTTGTCCAGCTGGCTCAGGG - Intergenic
1114499737 14:23159793-23159815 TTTCCTTTCCAAATAGCTCAAGG + Intronic
1114920351 14:27318806-27318828 CTCCGTTTCCAGATTTCTCATGG - Intergenic
1115517156 14:34197396-34197418 CTGCCTTTCCATATGGCTTAAGG + Intronic
1116544513 14:46147689-46147711 CATTATTTCCAAAAGGCTCATGG + Intergenic
1116552609 14:46261044-46261066 TTTTATTTCTAAATGGCTCAGGG + Intergenic
1118110805 14:62716999-62717021 TTTCATTTTCAGATGGTTCATGG - Intronic
1118550325 14:66942762-66942784 CTTCTTTTCTAGATGCCCCAGGG + Intronic
1124872088 15:33553278-33553300 CGTCATTACCAAATGACTCACGG - Intronic
1125472713 15:40020281-40020303 GGTATTTTCCAGATGGCTCAGGG + Intronic
1128382902 15:67126499-67126521 CTTCATGTTCAGGTGGCCCAGGG + Intronic
1130115981 15:81004174-81004196 CTTCAGTTCCAGGCTGCTCAAGG - Exonic
1130980788 15:88810575-88810597 CTGCATATCCAGATGGCTCAGGG + Intronic
1131415675 15:92254842-92254864 CTTTACTTTCAAATGGCTCAGGG - Intergenic
1131904209 15:97124373-97124395 ATTCATTTCCAAATGGCGCTAGG - Intergenic
1134022971 16:10934153-10934175 CTGCCCTTCCAGAGGGCTCAGGG - Intronic
1136687682 16:32004655-32004677 CCTCATTTACCGATGGCTAAGGG - Intergenic
1136788290 16:32948205-32948227 CCTCATTTACCGATGGCTAAGGG - Intergenic
1137864027 16:51875401-51875423 ATTCATTTGCATATGGCCCATGG + Intergenic
1138817043 16:60214590-60214612 CTTCATTTCCTGATTACTCAAGG + Intergenic
1140198574 16:72876268-72876290 CTTCAGCCACAGATGGCTCAGGG + Intronic
1140855248 16:78972160-78972182 CTTCATTTCCAGATGAAACTGGG + Intronic
1141942970 16:87290602-87290624 CTCCAATTCCTGATGGCTCTGGG + Intronic
1142659491 17:1417974-1417996 CTTCACTTCTAGATGGCTAAAGG + Intergenic
1143323238 17:6081270-6081292 CTGGAGTTCCACATGGCTCAAGG + Intronic
1143996179 17:11008341-11008363 CTTCATTTCCAGAAGGCTGCTGG + Intergenic
1145786472 17:27597175-27597197 CTTCCTTTCCAGATGGGGAAGGG + Intronic
1145978139 17:28996190-28996212 CCTTATTTCCAAATGGCTTAGGG + Intronic
1147148668 17:38500324-38500346 CCTCATTTACCGATGGCTAAGGG - Intronic
1148996360 17:51713706-51713728 CTGCATTTCCATATGGCCCTGGG + Intronic
1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG + Intergenic
1150917630 17:69452410-69452432 ATTCATTACCAGATAGCTAAAGG + Intronic
1151144188 17:72024553-72024575 CTTCATTTTCAGTTCCCTCATGG - Intergenic
1152459680 17:80434977-80434999 TTGCATTTCCTGATGGCTAATGG + Intronic
1154016106 18:10619365-10619387 CTTCAGGCCCAGATGGCTCTAGG + Intergenic
1154189407 18:12216276-12216298 CTTCAGGCCCAGATGGCTCTAGG - Intergenic
1155075752 18:22352830-22352852 GTTCATTACCAGATGGATGAAGG - Intergenic
1157718356 18:49904892-49904914 TTGCATTTGCAGATGTCTCAGGG - Intronic
1158021499 18:52847369-52847391 CTGGATTTTCAGGTGGCTCATGG + Intronic
1159087058 18:63804903-63804925 CATAATTTCCAGACGGGTCATGG - Exonic
1159672554 18:71239542-71239564 CTTCATTTCCTAGTGGGTCAGGG + Intergenic
1160273040 18:77404716-77404738 CTTTATTTCAAGATGACGCACGG - Intergenic
1161433294 19:4246894-4246916 CTCCAATTCCACATGGCTCCCGG + Intergenic
1162820040 19:13217365-13217387 CTTCCTTTCCAGCAGGCTAAGGG - Intronic
1163135107 19:15304867-15304889 AATCATTTCCTGATGGATCAAGG + Intronic
1163234309 19:16022141-16022163 TCTCATTTCAAGATGGGTCAGGG + Intergenic
1165352896 19:35286086-35286108 CATCATCACCAGATGGCTAATGG + Intergenic
1167692940 19:50998125-50998147 CTTGATTTGAAAATGGCTCAGGG - Intronic
1168650342 19:58088400-58088422 CTTTATTTTCAGAGGGTTCATGG + Intronic
925037468 2:701038-701060 CTTCATTTACAGATAACACATGG + Intergenic
927496613 2:23555529-23555551 CTTCCTTTCCTGTTGGCACATGG - Intronic
929994235 2:46815300-46815322 CTACGTTGCCAGATGGCTGAGGG + Intergenic
931177170 2:59865696-59865718 CTTCCTTTTTAGGTGGCTCAGGG - Intergenic
933992170 2:87641549-87641571 CACAAATTCCAGATGGCTCAAGG - Intergenic
934732131 2:96666053-96666075 CTGCATTTCCAAAGGGCTAAAGG - Intergenic
934874012 2:97896720-97896742 CTTCTTGTCCAGATGTGTCAAGG - Intronic
936301679 2:111309288-111309310 CACAAATTCCAGATGGCTCAAGG + Intergenic
937113711 2:119387953-119387975 CACCATTTCTAGATGACTCATGG - Intergenic
937217232 2:120320549-120320571 ATTCATTTCCAGATGCCTCTGGG + Intergenic
939728143 2:145749329-145749351 GCTCATTTGCACATGGCTCAAGG - Intergenic
940045970 2:149409847-149409869 CTTCTTTTCTCGATGGCTCATGG - Intronic
940959606 2:159769662-159769684 CTTCATTACCAGAGGCCTCTTGG + Exonic
941046377 2:160680261-160680283 CAGTATTTCCAGATGGTTCAAGG - Intergenic
942142978 2:172996526-172996548 CTTCATTTAAAGTTGCCTCAAGG - Exonic
942317122 2:174706816-174706838 CCTAATATCCAGATGGGTCAGGG - Intergenic
942950981 2:181721267-181721289 CTTGATCTCCAGATGGCACCTGG - Intergenic
943833328 2:192488898-192488920 GTTCATTTCCAGTTGTCTGAAGG - Intergenic
947240299 2:227987247-227987269 TTTCATGCCCACATGGCTCATGG + Intronic
947891422 2:233624954-233624976 CTTCATTCCCACATTGTTCAGGG - Intronic
947896370 2:233677338-233677360 CTTCATTCCCACATTGTTCAGGG - Intronic
948510245 2:238459097-238459119 CTTCCTTGCCAGCTGGCACAGGG - Intergenic
1168770342 20:410400-410422 ATTCATTCCCAGATTCCTCATGG + Intronic
1169071462 20:2734855-2734877 CTTCACTTCCTGCTTGCTCAGGG + Intronic
1170374204 20:15682127-15682149 TTTCATTTGGAAATGGCTCAAGG - Intronic
1171162295 20:22938845-22938867 CTACTTTCCCAGATGGCTCCAGG - Intergenic
1171297491 20:24031266-24031288 TTTCATTCACAGATGGCTCGAGG + Intergenic
1172362237 20:34321278-34321300 CTGCATTCCCAGATGGTTTAAGG + Intergenic
1173814269 20:45975124-45975146 CTTTATTTCCATTTGGATCAAGG + Intergenic
1175253464 20:57623628-57623650 CTTCATCTCCAGATGTGCCATGG - Intergenic
1176417672 21:6487387-6487409 CTGCATCTCCACATCGCTCACGG + Intergenic
1179278951 21:39917423-39917445 CATCATTCCCCGATGTCTCAGGG - Intronic
1179693166 21:43095718-43095740 CTGCATCTCCACATCGCTCACGG + Exonic
1183192568 22:36331177-36331199 CTTCATTCCCAGAGAGGTCAAGG - Intronic
1183766696 22:39883688-39883710 TTTCATTTTCAGATTGTTCATGG - Intronic
1184045492 22:41970129-41970151 AGTCAGTTCCAGAGGGCTCATGG - Intergenic
1185296150 22:50056319-50056341 TTGCATTTCCAGACAGCTCAAGG - Intronic
1185323903 22:50216356-50216378 CCTCATTTCCAGAAGGGTCCAGG - Intronic
949109677 3:243989-244011 GTTCATTCCCAGGTGTCTCAAGG - Intronic
950218432 3:11176398-11176420 CACTATTTCCAGATGCCTCATGG + Intronic
950856813 3:16113488-16113510 CTGCATTTCCAGATGGGTTTTGG - Intergenic
950941083 3:16892248-16892270 CTTCATTTAAAGATGGATCTAGG + Intronic
952252459 3:31667744-31667766 ATTCATTTACATATGGCTTATGG - Intronic
952408944 3:33030086-33030108 CTTCATTTCCAGGTGAATAAAGG + Intronic
952546452 3:34424997-34425019 CTTTATTTCCCTATGGCTGAAGG + Intergenic
952650220 3:35717286-35717308 TTTCATTTCCAGTAGGCTCTTGG + Exonic
954419664 3:50412046-50412068 CTTGACTTCCAGGAGGCTCAGGG + Intronic
954854693 3:53634042-53634064 CTTCATGTTCAGATGTCTCAAGG + Intronic
955887365 3:63614783-63614805 GATTATTTCCAGATGGCACAGGG - Intronic
956004179 3:64761363-64761385 CTTCACTCCCAGATGACCCAAGG - Intergenic
957451201 3:80384987-80385009 CTTCAGCTCCGGATGGCTCTAGG - Intergenic
958727189 3:97920415-97920437 CTTCATTCCCAGATTCCACATGG + Intronic
961805497 3:129486587-129486609 CTTCCTTTCCAGACCTCTCAGGG - Intronic
962269242 3:133966044-133966066 CTTCAGCTCCAGATGCCTGAGGG + Intronic
963557483 3:146811142-146811164 CTTCTTATCCAGATGGCACTTGG - Intergenic
963724621 3:148906084-148906106 CTGCATTTCCAGCAGGCTCCAGG - Intergenic
964096372 3:152935919-152935941 TGTCAATTCCTGATGGCTCAGGG - Intergenic
964562476 3:158012903-158012925 CTGGCTTTCCAGATGGTTCAGGG - Intergenic
965312527 3:167148560-167148582 CTTCATTTCCAGATAGTTACTGG + Intergenic
966427366 3:179793774-179793796 CTTCATTTCCAGATGGCTCAGGG + Intergenic
969490675 4:7497672-7497694 CTTCATCTCCACATGACCCAGGG + Intronic
970142099 4:12994049-12994071 CATCATTCCCAGATGGCACAGGG + Intergenic
971215777 4:24661181-24661203 CTGCATTCCCAGATGGTTAAGGG - Intergenic
977677103 4:99759691-99759713 CTTCAATTCCAGATCTCTAACGG - Intergenic
977677105 4:99759729-99759751 CTTCAATTCCAGATCTCTAATGG - Intergenic
978197928 4:105991980-105992002 CTTCATGTCCTCCTGGCTCATGG + Intronic
978430356 4:108626796-108626818 CTGCATTCCATGATGGCTCAAGG - Intronic
978928715 4:114284482-114284504 CTTGATTTCCATATTTCTCATGG + Intergenic
978985269 4:115004431-115004453 CTGCTTTTGCAGCTGGCTCATGG + Intronic
979932161 4:126644058-126644080 ATTCATTTACAGTTTGCTCAGGG + Intergenic
980543646 4:134229047-134229069 ATTCAAGTCAAGATGGCTCAAGG - Intergenic
981714174 4:147736643-147736665 CATCCTTTTCAGATGACTCAGGG + Intronic
982245805 4:153349236-153349258 CTTAATTTCAAGTTGGCTAAAGG + Intronic
982470486 4:155783609-155783631 CTTCAATTCCTGTTGGCTCCAGG + Intronic
985449903 4:190055825-190055847 TTTTTTTTCCAGTTGGCTCAGGG + Intergenic
986606273 5:9526619-9526641 CTTCAGTTGCTGATGGCTCAAGG - Intronic
988052020 5:26042719-26042741 CTTTATTTCTAGATGTGTCAGGG - Intergenic
988930251 5:36030101-36030123 CTTGGTTTACAGATGGCTCTGGG + Intergenic
991441388 5:66653608-66653630 TGTCATTTCCAGATGGGCCAGGG + Intronic
991531750 5:67623037-67623059 CGTCCTTTCCAGCTGGATCAGGG + Intergenic
991593229 5:68276352-68276374 AGACATTGCCAGATGGCTCATGG + Intronic
992452881 5:76889074-76889096 CTTGATTTGCATAGGGCTCAGGG - Intronic
995949774 5:117696455-117696477 CTGCATTTCCATATGGCTTTTGG + Intergenic
998896449 5:146805222-146805244 CTTCATGCACAAATGGCTCAGGG - Intronic
999356503 5:150938867-150938889 TTTCATTTTCAGATTGCTCATGG - Intergenic
999877609 5:155825519-155825541 CTTCGTCTCCATATGGTTCAAGG + Intergenic
1001451963 5:171833449-171833471 CCTCATTTCCTGATGGCTGGAGG - Intergenic
1001487861 5:172132625-172132647 CTATATTTGCAGGTGGCTCACGG + Intronic
1002629761 5:180563903-180563925 TTGAATTTACAGATGGCTCATGG + Intronic
1002969850 6:2004156-2004178 GTTCATTGCCAAATGGCTCTAGG + Intronic
1003140834 6:3469834-3469856 AATGATTTCCAGAGGGCTCAAGG - Intergenic
1006787362 6:36677639-36677661 CCTCATTTGCAGATGGTTTATGG - Intronic
1008487488 6:52051777-52051799 CTCAATTTCCAGAAGGCTGAGGG - Intronic
1013021118 6:106220172-106220194 CTTCTTTTGCAGATTGCTTATGG - Intronic
1013299606 6:108792056-108792078 TTTCTTTTTCAGATTGCTCATGG + Intergenic
1018046666 6:159971287-159971309 CTTCATCTCCAGGTGGAACACGG + Intronic
1020402284 7:7792864-7792886 CTTCATTTTCACATGGCAGAAGG + Intronic
1022116921 7:27269200-27269222 CTTCTTTTCCAGTTTGCTGAGGG + Intergenic
1023635597 7:42206637-42206659 CTTCCTTTTCAAATGGCTCTTGG - Intronic
1023829445 7:44030295-44030317 CTCCAGCTCCAGTTGGCTCAGGG + Intergenic
1024098000 7:46000287-46000309 TTTCAGTTCCAGATGGCATAAGG + Intergenic
1024225563 7:47323992-47324014 CATCAGTTCCAGATGGACCAAGG - Intronic
1024977225 7:55125064-55125086 CTGCATTTCCAGCAGGCTCCTGG + Intronic
1026924743 7:74182862-74182884 CTCCACTTCCAGATGGCAGATGG - Intronic
1028284907 7:88983804-88983826 CTTGATCTCCATTTGGCTCAGGG + Intronic
1029739752 7:102484553-102484575 CTCCAGCTCCAGTTGGCTCAGGG + Intronic
1029757753 7:102583732-102583754 CTCCAGCTCCAGTTGGCTCAGGG + Intronic
1029775689 7:102682793-102682815 CTCCAGCTCCAGTTGGCTCAGGG + Intergenic
1030130447 7:106195092-106195114 ATTCTTTTCCAAGTGGCTCATGG - Intergenic
1031971390 7:128067514-128067536 CTTCCTTCCCAGATGCCTCAGGG + Intronic
1033454664 7:141491947-141491969 TTTCATTTCAATATGGCTCCTGG - Intergenic
1035477775 7:159155803-159155825 CTTCTATTCCAGCTGGCACAGGG + Intergenic
1035771245 8:2148557-2148579 ATGCATTTCCAAATGGCTCTAGG - Intronic
1036074404 8:5478833-5478855 CTGCATTTCCAGAGCACTCAAGG + Intergenic
1038803689 8:30771707-30771729 ATTCACTCCCAGCTGGCTCATGG - Intergenic
1038965682 8:32568927-32568949 TTTCATTTTCACATGGCTCTTGG - Intronic
1039805877 8:40997672-40997694 TTTCATTTTCAGATTGTTCACGG + Intergenic
1039843867 8:41311869-41311891 CTTCCTTTCCAGCTGGGTCTGGG - Intergenic
1042602768 8:70514449-70514471 AATCACTTCCATATGGCTCAAGG + Intergenic
1044917536 8:97131532-97131554 TTTCATTTCCAGATATCACAGGG - Intronic
1046527263 8:115396485-115396507 CTTCATTTCAGTCTGGCTCAAGG - Intergenic
1047921525 8:129639596-129639618 CTACATAATCAGATGGCTCATGG + Intergenic
1049257572 8:141622016-141622038 CTTAGTTTCCAGATGGTACAGGG - Intergenic
1051557218 9:18397841-18397863 CTGGATTTCCAGATGTCTTAAGG + Intergenic
1052118266 9:24675850-24675872 CTACAGTTCCAGATGGTTCCTGG + Intergenic
1056745828 9:89301272-89301294 CCTCTTTTTCAGATGGTTCAGGG - Intergenic
1056776923 9:89519705-89519727 CTTCACTTCCTGCTGGCACAGGG - Intergenic
1057032545 9:91787010-91787032 TTTCATTTCCGGATTGCACAGGG - Intronic
1057417683 9:94879423-94879445 TTTCATTTCCAGAAGACTGAGGG + Intronic
1060815545 9:126633265-126633287 CTACATTTCCAGATGGCCCCTGG + Intronic
1061521002 9:131117798-131117820 CTTCATCTCCAGGTGGGTCTTGG - Exonic
1062436989 9:136550769-136550791 CGTCCTTTCCACGTGGCTCAGGG + Intergenic
1185886644 X:3789270-3789292 CTGCATTTCCAGATGATTGAGGG - Intergenic
1187491784 X:19759042-19759064 CTTCATTTCCCTATGTCTTATGG + Intronic
1190401952 X:50046008-50046030 CTTGTTTTCCAGATGGCTAGAGG + Intronic
1191152883 X:57240267-57240289 CTTCATTTCTAGATGATTCAGGG + Intergenic
1191204634 X:57821179-57821201 CTTCCTTTCCATATGACCCAGGG + Intergenic
1191768256 X:64725817-64725839 AATCAATTCCAGATGGATCAAGG + Intergenic
1191965700 X:66755121-66755143 AATCAATTCCAGATGGATCAAGG - Intergenic
1195835380 X:109109184-109109206 CTTCCTCTCAAGATGTCTCAAGG + Intergenic
1196015557 X:110936815-110936837 CTTCATTTCCCGTTGGAGCAGGG - Intergenic
1196908830 X:120465962-120465984 CTGCATTTTCTGATGGCTCTTGG - Intronic
1197792744 X:130271775-130271797 CTTCCTTTCCAGATGGCCTCTGG + Intergenic
1197934977 X:131730405-131730427 ATTCATATCAAGGTGGCTCAGGG + Intergenic
1198931817 X:141869963-141869985 CCTCTTTTCCAGATGCTTCAGGG + Intronic
1199157105 X:144563200-144563222 CCACAATTACAGATGGCTCAGGG + Intergenic
1200775618 Y:7167634-7167656 CATCATTTCCAGATGACTGAAGG + Intergenic