ID: 966427726

View in Genome Browser
Species Human (GRCh38)
Location 3:179798328-179798350
Sequence TCCCCATGACTCCTGAAAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966427726_966427728 -9 Left 966427726 3:179798328-179798350 CCATTTTTCAGGAGTCATGGGGA 0: 1
1: 0
2: 0
3: 21
4: 141
Right 966427728 3:179798342-179798364 TCATGGGGAGTGAGTTTTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 218
966427726_966427731 20 Left 966427726 3:179798328-179798350 CCATTTTTCAGGAGTCATGGGGA 0: 1
1: 0
2: 0
3: 21
4: 141
Right 966427731 3:179798371-179798393 AGGGAATGAATCAGTATGATTGG 0: 1
1: 0
2: 0
3: 20
4: 162
966427726_966427729 0 Left 966427726 3:179798328-179798350 CCATTTTTCAGGAGTCATGGGGA 0: 1
1: 0
2: 0
3: 21
4: 141
Right 966427729 3:179798351-179798373 GTGAGTTTTGGAGGAAGTAAAGG 0: 1
1: 0
2: 2
3: 53
4: 471
966427726_966427730 1 Left 966427726 3:179798328-179798350 CCATTTTTCAGGAGTCATGGGGA 0: 1
1: 0
2: 0
3: 21
4: 141
Right 966427730 3:179798352-179798374 TGAGTTTTGGAGGAAGTAAAGGG 0: 1
1: 0
2: 0
3: 31
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966427726 Original CRISPR TCCCCATGACTCCTGAAAAA TGG (reversed) Exonic
903147096 1:21381358-21381380 ACCACATGACTCCTGAGAAATGG - Intergenic
904544655 1:31259663-31259685 TCCACATGGCTCTTGTAAAAAGG + Exonic
904656932 1:32055815-32055837 TCCCCATTACTTCCCAAAAAGGG - Intronic
914685074 1:149971130-149971152 GCTCCAGGACCCCTGAAAAAGGG - Exonic
917646270 1:177032014-177032036 TTCCTATGACTCCTGAGAATTGG - Intronic
917978139 1:180253235-180253257 TTCTCATGTCTCCTCAAAAAGGG + Intronic
924067019 1:240234294-240234316 TCCCGATGACCCCTGAAAAGAGG + Intronic
1063862377 10:10325090-10325112 TCCCCATTACTAATGGAAAAAGG - Intergenic
1064811015 10:19198315-19198337 TCTCCATGTCCCCTGAGAAAGGG + Intronic
1066011342 10:31196527-31196549 TCCCCATACCTCCTCAACAATGG + Intergenic
1066508412 10:36068048-36068070 TCCTCATGACTTCTGTAATAAGG - Intergenic
1068132009 10:52906765-52906787 TAATCATGATTCCTGAAAAAAGG + Intergenic
1069898189 10:71691855-71691877 TCCCCAAGCCTCCAGGAAAAGGG - Intronic
1070476126 10:76830803-76830825 TCCCCTTGACTCTAGAAAACAGG - Intergenic
1072417324 10:95260036-95260058 TCCCCATCACTTCTGAGAACTGG - Intronic
1073480112 10:103781042-103781064 TCCCCATCACTCCTGCAGATCGG + Intronic
1077723036 11:4646419-4646441 TCCCCATGTCTCCTTAAGAAGGG - Intronic
1079703646 11:23585123-23585145 TCCCCTTGACATCTTAAAAAGGG + Intergenic
1080005800 11:27405189-27405211 TGCCCATGACTAGTGAGAAAGGG - Intronic
1081997649 11:47375644-47375666 TCCCCATCACTGCTGAGATAGGG + Exonic
1084533242 11:69741782-69741804 TCCCCAGCACTCCTGCAACAGGG - Intergenic
1087086483 11:94224188-94224210 TCACCATGACAAATGAAAAATGG - Intergenic
1089092622 11:115890754-115890776 TCCCCACAACTCCCGAGAAAAGG - Intergenic
1095132849 12:38564376-38564398 TGACCATGAGTCCTGAAATATGG + Intergenic
1095324987 12:40878714-40878736 TCGCCATGATTCCCGAAATAGGG + Intronic
1096085417 12:48862303-48862325 TCCCCCTTAGTCCAGAAAAAGGG + Intronic
1096203052 12:49699511-49699533 ACCCAATGAGTCCTGAGAAAGGG + Intronic
1098513649 12:71348538-71348560 TCTCCAAGCCTCCTGAAATAGGG - Intronic
1098533435 12:71568067-71568089 TCCCCATTTCTCCAGAAAACTGG + Intronic
1098728230 12:73997023-73997045 TCCTTATGACTTCTTAAAAAAGG - Intergenic
1100658692 12:96674265-96674287 TGCCAATGACTCCTGAGAAAGGG - Intronic
1105684060 13:22760120-22760142 ACCCCATGTCTACTAAAAAATGG + Intergenic
1106874166 13:34054223-34054245 CCCCCGTGCCTCCTGAAATATGG - Intergenic
1106950761 13:34881064-34881086 TCCCCATCAGTCCTCACAAAAGG - Intergenic
1106968017 13:35096555-35096577 TCCCTATGATCCATGAAAAAAGG - Intronic
1110594884 13:77309190-77309212 TTTCCCTGCCTCCTGAAAAAAGG + Intronic
1113936501 13:113997749-113997771 TCCCCCTGACTCCTGACTTAAGG - Intronic
1117130047 14:52677086-52677108 TGCCCATTTCTCCTGAGAAAAGG - Intronic
1117301999 14:54439459-54439481 TCCCCATCATCCCAGAAAAAAGG + Intronic
1119628019 14:76198971-76198993 GCCCTATGACTCCTGAGAAAAGG - Intronic
1120403474 14:84063677-84063699 GCCCCATTATTCATGAAAAATGG + Intergenic
1122042224 14:98996948-98996970 TCCCCATGCATCCTGGAAGAGGG - Intergenic
1122195914 14:100085813-100085835 ACCCCAGGACCCCTGATAAAAGG + Intronic
1124421590 15:29527677-29527699 TCTCCATGGCTCATGAAGAATGG - Intronic
1124577965 15:30926199-30926221 TCCCCCTGACTTCTGTACAAAGG - Intronic
1126657281 15:50992360-50992382 TACCAATGACCCTTGAAAAATGG - Intronic
1127644835 15:60947727-60947749 TACCCATGACTTCTGGAAAACGG - Intronic
1128258896 15:66218049-66218071 TCCCAATAAATCCTGTAAAATGG - Intronic
1128790529 15:70430195-70430217 TCCCAAGGAATCCTGAGAAATGG + Intergenic
1129014114 15:72450725-72450747 TCACCATGCCTCCTGCAACAAGG - Intergenic
1130083942 15:80761643-80761665 TTCACATGAATCCTGAAGAATGG - Intergenic
1131411600 15:92212232-92212254 GCCCCATTCCTCCTTAAAAAAGG + Intergenic
1131973971 15:97923063-97923085 TCCCAATAAATCCTGGAAAAAGG + Intergenic
1132627411 16:898090-898112 TCTCCATGGCTCCTGATGAAGGG + Intronic
1138985568 16:62324108-62324130 TTCCCTTGACACCTGAAAATGGG + Intergenic
1139560846 16:67741006-67741028 TCCCCAAGAAGCCTGGAAAAAGG + Intronic
1140767938 16:78177424-78177446 CTCCCATGACTCATGAAAGATGG + Intronic
1142052251 16:87966394-87966416 TCCCCAGGACTTCTGAGAAATGG + Intronic
1142164144 16:88576655-88576677 TCAGGATGACTCCAGAAAAATGG + Intronic
1143950003 17:10624858-10624880 TCCCCAGGACTTTTGAACAAGGG + Intergenic
1145070014 17:19796905-19796927 TCCCATTTAATCCTGAAAAAAGG - Intronic
1149915320 17:60603005-60603027 TTTCCATGTGTCCTGAAAAAAGG - Intronic
1150971475 17:70032791-70032813 TCATCATTACTCCTGAACAATGG - Intergenic
1153952493 18:10069071-10069093 TCCCCATGGCTCCTGCAAATGGG - Intergenic
1154012373 18:10586632-10586654 TTCCCATGATTCCTGGAAAATGG + Intergenic
1154366098 18:13710510-13710532 ACCCCATGACTCATGAAGTAAGG - Intronic
1155894378 18:31305204-31305226 TCCATATGACTCCTGAAGAGAGG - Intergenic
1159975985 18:74712477-74712499 TCGCCATGACTACTGGGAAAAGG - Intronic
1160666861 19:334912-334934 ACTCCATGACTCCTGAAACGGGG + Intronic
1161052271 19:2170795-2170817 TGCCCATGAATACTGAGAAATGG + Intronic
1164905205 19:31961442-31961464 TCCCCATCACTACTGAGAACAGG - Intergenic
1165529963 19:36390450-36390472 TCCCCATGTTTCCTGTAAACTGG + Intronic
1165579258 19:36848273-36848295 ACCCCATGACTTCTGGGAAAAGG + Intronic
1166102362 19:40578283-40578305 TCCCCTTCTCTCCTGAAAGAGGG + Intronic
1167563638 19:50242076-50242098 CCCACATGGCTTCTGAAAAATGG - Intronic
934667787 2:96185411-96185433 CCCTCAAGACTCCAGAAAAAAGG + Exonic
936442514 2:112567271-112567293 TCCCCATGAGTTCTGACACATGG + Intronic
936765701 2:115846009-115846031 TCTCCAGCACTCCTGAAATAAGG + Intergenic
937322927 2:120971691-120971713 TCCCCAAGACTTCTGGGAAATGG - Intronic
938387670 2:130878901-130878923 TCCCCATGATGCCCAAAAAATGG - Intronic
939996362 2:148924338-148924360 TCCCCGTGATTCCTGATAATGGG + Intronic
946404708 2:219486225-219486247 ACCCCATCCCCCCTGAAAAAGGG + Intronic
947263685 2:228252586-228252608 CCCCAGTGACTCCTGGAAAAAGG - Intergenic
947493737 2:230617830-230617852 TCTCCATCACAGCTGAAAAAGGG + Intergenic
948398414 2:237664160-237664182 TCCCCATGACTTCACTAAAACGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170328102 20:15178583-15178605 TCCCTATCAATCCTGAAAATGGG + Intronic
1172128317 20:32638718-32638740 TCCTCTTCTCTCCTGAAAAATGG + Intergenic
1173643407 20:44618817-44618839 TCTCCATATCTGCTGAAAAAAGG - Exonic
1175664457 20:60846219-60846241 TTCCCACCACTCCTGAAAAAGGG - Intergenic
1177631786 21:23738274-23738296 GCCACATGACTCCTGAAGAAGGG - Intergenic
1184373911 22:44099766-44099788 TCCTTATTTCTCCTGAAAAATGG + Intronic
1184785390 22:46669129-46669151 CCCCCATGTCTCCTGCAAAGTGG + Intronic
949242862 3:1892050-1892072 TCTCCATGAGACCTGAAAAGGGG - Intergenic
955879751 3:63530776-63530798 TCTCCATAACTCCTTAAAACTGG - Intronic
958438599 3:94128526-94128548 TTCCTATGATTACTGAAAAATGG + Exonic
958834271 3:99125842-99125864 TCACCATGATTCCTGAACAAAGG - Intergenic
960785909 3:121372567-121372589 CCCCAATGACTCCTGCAAAAGGG - Intronic
960921309 3:122749454-122749476 TCACAATGACTCCTGAATAAAGG + Intronic
962649065 3:137470061-137470083 ACCCCAACACTTCTGAAAAAGGG - Intergenic
964420975 3:156502220-156502242 GCCAAATGACTCCTGAAAATGGG + Intronic
966000194 3:174940081-174940103 TCCCCATTCCTCTTGAAAACTGG - Intronic
966427726 3:179798328-179798350 TCCCCATGACTCCTGAAAAATGG - Exonic
967449607 3:189609271-189609293 TCCCTTTTTCTCCTGAAAAACGG + Intergenic
968125888 3:196160046-196160068 TGCCCAGGGCTCCTGAACAAAGG - Intergenic
969670529 4:8587626-8587648 TCGCCATGACCCCAGAACAAGGG - Intronic
974101706 4:57424199-57424221 ACTCCATGACTTCTGAAAAGGGG + Intergenic
974355925 4:60812778-60812800 TCCTTATGAGTCCTGAAAAGCGG - Intergenic
975307051 4:72861909-72861931 ACCCCATGGCACCTGAGAAAGGG + Intergenic
975694362 4:76997177-76997199 TCCCCATCACGCCTGATGAATGG + Intronic
976868069 4:89755388-89755410 TCCTCAGAACTCCTGACAAAGGG + Intronic
977855550 4:101886291-101886313 TCCCACTGCCTCCTCAAAAAGGG - Intronic
979491341 4:121331529-121331551 TCTCCATGACTTCTGTAAAGAGG + Intronic
981351961 4:143741161-143741183 TTCACATGACTACTGAAACAAGG - Intergenic
982778624 4:159467111-159467133 TCCCCAGGAGTGCTGGAAAAGGG - Intergenic
982869838 4:160564921-160564943 TCAGCATGAAGCCTGAAAAAAGG - Intergenic
983680094 4:170343571-170343593 CACCCAGGACACCTGAAAAAAGG - Intergenic
988371419 5:30373149-30373171 TGGCTGTGACTCCTGAAAAAAGG + Intergenic
990014762 5:51046230-51046252 ACCCCTTTACTCCTGAAGAAAGG - Intergenic
991443338 5:66674669-66674691 TCCCCAGGAATTCTGAAAGATGG - Intronic
994829315 5:104758469-104758491 TCCCCCTATCTTCTGAAAAATGG - Intergenic
994909292 5:105882359-105882381 TCCACATGGCATCTGAAAAATGG + Intergenic
995027263 5:107438557-107438579 TCCCCATGACTCCTGCTAACTGG - Intronic
997078706 5:130712693-130712715 TCCTCATTTATCCTGAAAAATGG + Intergenic
998161689 5:139816559-139816581 TTCCCATGAGTCCTGCAAATGGG + Intronic
1000983067 5:167837777-167837799 TTCCCATGCTACCTGAAAAAGGG + Intronic
1005510593 6:26508747-26508769 ACCCCATGACTCCTGAGAATGGG + Exonic
1005609970 6:27514409-27514431 TCCTTAGCACTCCTGAAAAATGG + Intergenic
1006781311 6:36634276-36634298 TCCACAGGATTCCTGAAAAAGGG + Intergenic
1007488588 6:42199945-42199967 TCCCCATCACTCCACAGAAATGG + Intergenic
1007863744 6:44944243-44944265 TTACCATGACTACTGAAAAAAGG + Intronic
1011553373 6:88549742-88549764 TCCACATAACTGCTGAAGAATGG - Intergenic
1013463778 6:110399905-110399927 TCCCCAGGACTCGGGTAAAAGGG + Intronic
1015504031 6:133963217-133963239 TCTCCATAAATCCTTAAAAAGGG - Intronic
1015838466 6:137449189-137449211 TCTTCATGACTGCTGCAAAAAGG + Intergenic
1015953479 6:138576861-138576883 TACCCATCACTGCTGACAAAGGG + Intronic
1018503712 6:164441711-164441733 TGCCGATGACTCATGAAAAATGG - Intergenic
1022612816 7:31894378-31894400 TTCCCATGAAGTCTGAAAAATGG + Intronic
1026083691 7:67244725-67244747 TCTCCATTAATTCTGAAAAAGGG - Intergenic
1026622784 7:71964974-71964996 TTCCCCTGAATCCTCAAAAACGG - Intronic
1026693352 7:72569329-72569351 TCTCCATTAATTCTGAAAAAGGG + Intronic
1029045439 7:97622975-97622997 TCCCCATTACACCTAGAAAAAGG + Intergenic
1029179009 7:98685856-98685878 TCCCCATGACTCCTCAGGTAAGG - Intergenic
1030260913 7:107563594-107563616 TCCCCAAGACTCCAGAAAAGAGG + Intronic
1031547595 7:123068910-123068932 TCCCAGTGACTCCTGGGAAAGGG - Intergenic
1042363703 8:67911937-67911959 TTCCCATGATTCCTCCAAAATGG + Intergenic
1045394598 8:101748201-101748223 TCCCCATGGCTTATTAAAAAGGG + Intronic
1046526653 8:115389553-115389575 TCTACATGACTTCTGAAAATGGG + Intergenic
1046717451 8:117583409-117583431 TTACAATGACTCCTTAAAAAAGG - Intergenic
1053604449 9:39642691-39642713 TCCCCATGTCTCCTAAGATACGG + Intergenic
1053862266 9:42398732-42398754 TCCCCATGTCTCCTAAGATACGG + Intergenic
1054249092 9:62699723-62699745 TCCCCATGTCTCCTAAGATACGG - Intergenic
1054563206 9:66734256-66734278 TCCCCATGTCTCCTAAGATACGG - Intergenic
1054818328 9:69497177-69497199 TCTCCATGACTCATCAATAATGG + Intronic
1055836877 9:80454300-80454322 TCCCTATGACTTTTGAAACATGG + Intergenic
1057604901 9:96492203-96492225 TCCCCAAGTCTCCTGAAAAGTGG + Intronic
1060034683 9:120244472-120244494 TCTCCATGAAGCCAGAAAAATGG + Intergenic
1061829097 9:133279332-133279354 TCTCCATGACACCTGCAAAGGGG + Intergenic
1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG + Intronic
1188018926 X:25135707-25135729 TCCCCTTCACTCCTGAAGGATGG + Intergenic
1192996892 X:76521255-76521277 TCCCAATGACTCCTGTGCAAGGG - Intergenic
1197622479 X:128765978-128766000 TGCCCATAACTCCTTAAGAAAGG + Intergenic
1198246558 X:134837503-134837525 TTACCATGTATCCTGAAAAATGG + Intronic