ID: 966431661

View in Genome Browser
Species Human (GRCh38)
Location 3:179837822-179837844
Sequence ACAGGCTGCTTGGTTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 2, 1: 2, 2: 9, 3: 14, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966431661 Original CRISPR ACAGGCTGCTTGGTTAAAAC AGG Intronic
903971012 1:27118816-27118838 ACAGACTGCTGGGGTAGAACTGG - Intronic
904286602 1:29456768-29456790 ACAGGCTGATAGGTCAGAACAGG - Intergenic
905664334 1:39753445-39753467 AAATGCTGCTTGCTTCAAACAGG - Intronic
908217168 1:61965756-61965778 ACTGCCTCCTCGGTTAAAACGGG - Intronic
909905485 1:81189569-81189591 ACTCTCTGCTTGGTTAAACCTGG + Intergenic
910352452 1:86313949-86313971 ACAAGCTGCTTAGTTAAAATAGG + Intergenic
911526167 1:98989169-98989191 ACAGCCTATTTGGTTAAAATGGG + Intronic
911826295 1:102489229-102489251 TCAGGCTGCTTGGTTATCAGAGG + Intergenic
917662702 1:177193114-177193136 ACAGGCAGTGTGGTAAAAACTGG + Intronic
918180247 1:182081081-182081103 ACAGGCTGCTTATTCAAAGCTGG + Intergenic
921771459 1:219045561-219045583 ACAGGCTGCTTGGCTAAAATGGG + Intergenic
922045531 1:221941716-221941738 ACAGGTTATTTGGTTAAAATGGG - Intergenic
922761761 1:228137239-228137261 ACAGGCTACTTGGTTAAAATGGG + Intergenic
923694815 1:236237662-236237684 AGAGGCAGCTGGTTTAAAACAGG + Intronic
1063798299 10:9538915-9538937 ACAGGCCACGTGGTTACAACAGG - Intergenic
1064666093 10:17653372-17653394 ACAGGTTGTTTTGATAAAACAGG + Intronic
1068787895 10:60996815-60996837 ACAGGATGCCTAGTTAAATCTGG - Intronic
1072761103 10:98057537-98057559 ACAGGCTGATCGGTTAACAAAGG - Intergenic
1074751381 10:116590761-116590783 ACAGAATGCTTGGTTAAAGCAGG - Intronic
1074838751 10:117326888-117326910 AAAGGCGACTTGGTTAAAATGGG + Intronic
1079497690 11:21064295-21064317 ACAGGCTGCTGTGGTAAAAACGG + Intronic
1082188342 11:49211024-49211046 ACAGGATGCTTGGTTACAGATGG - Intergenic
1082661657 11:55919923-55919945 ACAGGCTCCTGGGTTCAAAGGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1086678179 11:89635619-89635641 ACAGGATGCTTGGTTACAGATGG + Intergenic
1087728944 11:101756924-101756946 ACAGGTGGCTTGTTTAAAATAGG - Intronic
1092272073 12:7031278-7031300 ACAGGCTCCTGGGTGAAAAGGGG - Intronic
1092556318 12:9566044-9566066 ATAGCCTCCTTGGTTAAAAATGG - Intergenic
1094515776 12:31124608-31124630 ATAGCCTACTTGGTTAAAAATGG + Intergenic
1096507607 12:52105047-52105069 TTAGGCTGCCTGGTTCAAACTGG - Intergenic
1096584313 12:52609687-52609709 AAATGGTGCTTGGTTAGAACAGG + Intronic
1098878393 12:75891220-75891242 GCAGGATTCTTTGTTAAAACTGG - Intergenic
1100795327 12:98176022-98176044 ATAGGCTGATTGGTCAAACCTGG + Intergenic
1100898320 12:99210696-99210718 ATTGGCTACTTGGTTAAAATGGG + Intronic
1101165550 12:102027694-102027716 ACAGCCTGCTAGGTTAAATAAGG + Intronic
1103506529 12:121444983-121445005 ACAGGCTGCTTGTTTGTAGCTGG - Intronic
1104288451 12:127446840-127446862 ACAAGCTGCTTCTTTAAAAATGG - Intergenic
1106472397 13:30068798-30068820 ACAGGCGACTTGGTTAAAATGGG + Intergenic
1109396519 13:61766292-61766314 ACAGGCTGCTGGGTAGAAAGTGG - Intergenic
1109552542 13:63922247-63922269 ACAGGCAACATGGTTACAACAGG - Intergenic
1111622318 13:90740307-90740329 ACAGCTTGATTGGTTAAACCTGG + Intergenic
1113186983 13:107699018-107699040 ACAGGCTGCTTGAGTAAGATAGG - Intronic
1115907829 14:38220896-38220918 GCAGGCTGCTTGGTTGAAAATGG - Intergenic
1117285499 14:54282641-54282663 ACAGGCTGCTGGGTGGAAAGAGG - Intergenic
1118998533 14:70859831-70859853 ACAGGCCGCTTGGTTAAAATAGG - Intergenic
1119393656 14:74309421-74309443 TCTGGCTGCTTTGTAAAAACTGG - Intronic
1120517641 14:85489583-85489605 ACAGGGTTCTTTGCTAAAACTGG - Intergenic
1121772377 14:96558895-96558917 ATAGGCTGTTTGTTTAAATCTGG + Intronic
1122570779 14:102698572-102698594 AAGGTCTGCTTGTTTAAAACTGG - Intronic
1128482463 15:68051662-68051684 GCAGGCTACTTGGTGAAAACAGG + Intergenic
1130128537 15:81116005-81116027 ACAGGCCACATGGTTACAACAGG - Intronic
1130686160 15:86039739-86039761 ACAGTGTTCTTTGTTAAAACTGG - Intergenic
1133707788 16:8371890-8371912 AAAAGCTCCCTGGTTAAAACTGG + Intergenic
1135002135 16:18785782-18785804 ATAGCTTGCTTGGATAAAACTGG - Intronic
1136271798 16:29152940-29152962 CCAGGCGGCATGGTTAAGACAGG - Intergenic
1142075464 16:88115100-88115122 CCAGGCAGCATGGTTAAGACAGG - Intronic
1146113031 17:30108989-30109011 ACAGGCATATAGGTTAAAACTGG - Intergenic
1146891691 17:36510554-36510576 AGACGCTGCTTGGTGAAACCTGG + Intronic
1150620823 17:66806657-66806679 ACAGCCTGCCTGTTTAAAGCAGG + Exonic
1151942134 17:77299601-77299623 ACAGGATGCTCAGTTAAACCTGG - Intronic
1154391914 18:13944967-13944989 ACAGGCTACTTGAATAAATCAGG + Intergenic
1155644306 18:28058943-28058965 ACAGGCTATTTGGTTAAAACAGG + Intronic
1156327252 18:36085535-36085557 ACAGGCTTCTGGGTGAAAAAGGG + Intergenic
1159498403 18:69236036-69236058 ACAAAATGCTTGATTAAAACTGG + Intergenic
1159517100 18:69471608-69471630 ACTGGCTGCTGTGTTACAACTGG + Intronic
1160336819 18:78049211-78049233 ACAGGCTCCTAGCTGAAAACAGG - Intergenic
1162077381 19:8196787-8196809 ACAGGCTCCTTGGTCAATCCAGG - Intronic
1165722147 19:38087065-38087087 GCAGGGTTCTTTGTTAAAACTGG + Intronic
1166264887 19:41674010-41674032 ATATGCTGCTTGATTAAAATGGG - Exonic
1166273196 19:41731365-41731387 ACATGCTGCTTGGTTAAAATGGG + Intronic
925748712 2:7067933-7067955 ACAGGATTCTTGCTGAAAACAGG - Intronic
928462282 2:31485843-31485865 TCAGACTGCTTAGTTTAAACGGG - Intergenic
929141928 2:38674147-38674169 ACAGGATGCCTGGTTAAATGTGG + Intronic
929830292 2:45341889-45341911 CCAGGCTTCTAGGTGAAAACTGG - Intergenic
931689550 2:64823482-64823504 AGAGGCTGCTTGGGTACAAAAGG - Intergenic
932427634 2:71650551-71650573 TCAGGCTACTGGGTTAAATCAGG - Intronic
932788761 2:74633446-74633468 ACAGGATTCTTGCTGAAAACAGG - Intronic
933293245 2:80461164-80461186 ACAGGATTCTTTGTTAAAACTGG - Intronic
935851104 2:107219925-107219947 ACAGCCTGCTTGATTAAAGAGGG + Intergenic
937423200 2:121775448-121775470 ACAGCCTGGTTGGTTACAGCTGG + Intergenic
941245687 2:163093270-163093292 ACAAGCTACTTGGTTAAAGCAGG + Intergenic
942385529 2:175438894-175438916 AGAGCATGCTTGGTTAAAGCTGG + Intergenic
944653865 2:201858469-201858491 TCAGCCAGCTTGCTTAAAACGGG - Intronic
948334944 2:237200543-237200565 ACAGGCTCCTTGGTGGAAAGGGG - Intergenic
948433486 2:237935917-237935939 ACAGGATGCTTGCTGAAGACAGG - Intergenic
1168889631 20:1286458-1286480 ATAGGCTCCTGGGCTAAAACAGG + Intronic
1170409804 20:16076396-16076418 ACAGGCCACATGGTTACAACAGG - Intergenic
1172233063 20:33350115-33350137 CCAGGCTGATTCGTTGAAACAGG + Intergenic
1174697297 20:52573035-52573057 ACAGGCTGCTTTGTGAAAAGTGG + Intergenic
1176425439 21:6545686-6545708 ACAGCCTGATTGGTGAGAACAGG + Intergenic
1179700930 21:43154003-43154025 ACAGCCTGATTGGTGAGAACAGG + Intergenic
1180903882 22:19394925-19394947 CCAGGCTCCTGGGTTAAAAAGGG - Intronic
1181497078 22:23293348-23293370 CCAGGCTGCTTGGTCTACACGGG + Intronic
1181530593 22:23514892-23514914 AGAGGAGGCTGGGTTAAAACAGG + Intergenic
1184251037 22:43260480-43260502 AGAGGCTGCTTGGCTAAGCCAGG + Intronic
952427957 3:33194406-33194428 ACTGGCTGGTTGGTTACAAGGGG + Intronic
952547438 3:34435694-34435716 ACAGGCTACTTTTTGAAAACAGG - Intergenic
955811856 3:62799308-62799330 ACAGGCTACATGGCTAACACTGG - Intronic
955992392 3:64642193-64642215 ACAGCTTGCTTGAATAAAACTGG + Intronic
956286630 3:67617169-67617191 AAGGCCTGCTTGTTTAAAACAGG + Intronic
958498424 3:94874910-94874932 ACAGGCTACTGGGTGAAAAGAGG - Intergenic
958959097 3:100492297-100492319 ACAGACCGCTTTGTTTAAACAGG - Intergenic
959499867 3:107093643-107093665 ACTGGCTGCCTGGCTAAAAGTGG - Intergenic
960887666 3:122413031-122413053 ACAGGATGATTGATTAAAAGAGG - Exonic
961337331 3:126188917-126188939 ACAGGCTATTTGGTTAAAATGGG - Intronic
963914488 3:150845463-150845485 ACAGGCTGCTTGGTCAAAATGGG - Intergenic
964527086 3:157626466-157626488 ATTGGCTGCTAGCTTAAAACTGG + Intronic
964877949 3:161390684-161390706 TTAGGCTGCTTGGTTAAATAAGG + Intergenic
965925180 3:173970309-173970331 ACAGGGTGCGTTGTGAAAACAGG + Intronic
966225870 3:177597388-177597410 CCAGGCTGCTGGGTTTAAAATGG - Intergenic
966431661 3:179837822-179837844 ACAGGCTGCTTGGTTAAAACAGG + Intronic
970126835 4:12823248-12823270 ACAGGCTGCTTGGTTAAAACAGG + Intergenic
971608120 4:28684956-28684978 ACAGGGTGCTAGCTTATAACAGG - Intergenic
972277378 4:37569800-37569822 AAAGGCTCCCTGGTCAAAACAGG - Intronic
973370602 4:49245116-49245138 ACAGGTTACTTGTTTAAATCAGG - Intergenic
973799970 4:54467677-54467699 ATAAACTGCTTGATTAAAACTGG - Intergenic
975431947 4:74303782-74303804 ACAGGATTCTTTGCTAAAACTGG + Intergenic
976797114 4:88946652-88946674 ACGGGCTACTTGGTTAAAACAGG + Intronic
978165377 4:105601022-105601044 TCTGGCTGCTTGGTTGAAACAGG - Intronic
978560474 4:110028646-110028668 ACAGTCTGATTGTATAAAACCGG + Intergenic
979071292 4:116210575-116210597 ACAAGCTACCTGATTAAAACTGG + Intergenic
982334221 4:154215456-154215478 ACAGGCTGATTGGATGTAACAGG + Intergenic
983677471 4:170312470-170312492 ACAGGCTTCTTGCTGAAGACAGG - Intergenic
986162660 5:5244593-5244615 ACAGGTAACTTGGTTCAAACAGG + Intronic
987878083 5:23706879-23706901 ACAGGCTGCTTGGTTAAACAAGG + Intergenic
987951972 5:24687435-24687457 ACAGGCTCCTGGGTGAAAAAAGG - Intergenic
992185611 5:74241631-74241653 ACAGGCTGCTTAGTTAGCAATGG - Intergenic
992827603 5:80566456-80566478 AGAGGCAGCTTGCTGAAAACAGG + Intronic
993674934 5:90805602-90805624 GCAGGCTGCTTGGTGAGAAAAGG + Intronic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
996723614 5:126653924-126653946 ACAGGCCACATGGTTACAACAGG + Intergenic
998274148 5:140735991-140736013 ACAGGCTGCCTGGTTACAGGAGG + Intergenic
998375162 5:141685866-141685888 ACAGGCTGATTGATTAAAATAGG - Intergenic
998770815 5:145542969-145542991 ACAGCTTGCTTGGTAAGAACTGG - Intronic
999644890 5:153707854-153707876 ACTGGCTGCTTGGCCAATACTGG + Intronic
1006779328 6:36621484-36621506 AGAGGCTGCTTGGTGAACATGGG + Intergenic
1006934636 6:37708828-37708850 ACATGCTGCTTGTAGAAAACTGG + Intergenic
1008664682 6:53704700-53704722 ACAGGATACCTGGTTAAATCTGG + Intergenic
1009322328 6:62307695-62307717 TCAGGCTGGTTGGTTGGAACAGG + Intergenic
1010578707 6:77566758-77566780 ACAGGATTCTTGCTGAAAACAGG - Intergenic
1011288185 6:85747140-85747162 ACAGGCTACTTGCCTAAAATAGG - Intergenic
1011415434 6:87114853-87114875 ACAGGCCACATGGTTACAACAGG + Intergenic
1012669312 6:102020613-102020635 ACAGGGTTCTTTGCTAAAACTGG + Intronic
1013675913 6:112462441-112462463 ATAGGCAGCTTGTTTAAAAGGGG - Intergenic
1017788951 6:157778807-157778829 ACAGGCTCCTAGGTGGAAACAGG + Intronic
1020880844 7:13761714-13761736 ACAGGCTGCTTGGTTAAAATGGG - Intergenic
1022862166 7:34378647-34378669 ATAGGCTGCTTGGTTAAAATGGG - Intergenic
1028281308 7:88932674-88932696 ACAGGCTCCTAGATTAAATCAGG + Intronic
1029836699 7:103319608-103319630 AAAGGCTGCTTTGGAAAAACAGG - Exonic
1030274495 7:107705516-107705538 GAAGACTTCTTGGTTAAAACAGG - Intronic
1032008520 7:128324676-128324698 ACAGGCTGGTGGGCTTAAACTGG - Exonic
1032377855 7:131441635-131441657 AAAGGTTTCTTGGTTTAAACTGG + Intronic
1032866583 7:135931407-135931429 ACAGGCTGATTAGGTAAACCAGG + Intronic
1042598383 8:70473321-70473343 ACAGCCTGATTGGTTACAGCTGG - Intergenic
1044239358 8:89870493-89870515 ACAGGCTGCTTGGGGAAAAAAGG - Intergenic
1046033479 8:108811953-108811975 GCAGGCTACTTGGTTAAAATGGG + Intergenic
1049826860 8:144674626-144674648 ACAGGCTCCTGGGTGAAAAGGGG - Intergenic
1051110318 9:13627783-13627805 ACATGCTTGTTGGTTACAACAGG - Intergenic
1051686394 9:19662731-19662753 ACAGGGTGCTTTTTGAAAACAGG - Intronic
1054362208 9:64134568-64134590 ACAGGTTACTTGTTTAAATCAGG + Intergenic
1056853884 9:90108381-90108403 ACAGGCTGGTTGGAGGAAACAGG + Intergenic
1057647939 9:96894440-96894462 ACAGGATTCTTGCTGAAAACAGG - Intergenic
1058191344 9:101919795-101919817 TCAAGCTGCTTGGTTACAAAAGG + Intergenic
1058880694 9:109283692-109283714 ATAGACTGCTTGATAAAAACAGG + Intronic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1061603791 9:131692906-131692928 ACAGGCTGCTTGGCTAAAACAGG + Intronic
1194950959 X:100125197-100125219 ACAGGATGTTTTCTTAAAACTGG + Intergenic
1195099095 X:101536900-101536922 AGATGCTGCTTGCTTAAAATTGG - Intergenic
1199604964 X:149569941-149569963 ACAGGCTGGTTGGTTAGAATGGG - Intergenic