ID: 966435874

View in Genome Browser
Species Human (GRCh38)
Location 3:179883407-179883429
Sequence TTAGTTCAGCTAATCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966435873_966435874 -8 Left 966435873 3:179883392-179883414 CCTGTCTTCTTCACTTTAGTTCA 0: 1
1: 0
2: 4
3: 34
4: 285
Right 966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG 0: 1
1: 0
2: 1
3: 9
4: 176
966435870_966435874 16 Left 966435870 3:179883368-179883390 CCAGTCACCCTTGTAGCACTTTG 0: 1
1: 0
2: 0
3: 17
4: 117
Right 966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG 0: 1
1: 0
2: 1
3: 9
4: 176
966435871_966435874 9 Left 966435871 3:179883375-179883397 CCCTTGTAGCACTTTGTCCTGTC 0: 1
1: 0
2: 1
3: 13
4: 125
Right 966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG 0: 1
1: 0
2: 1
3: 9
4: 176
966435872_966435874 8 Left 966435872 3:179883376-179883398 CCTTGTAGCACTTTGTCCTGTCT 0: 1
1: 0
2: 1
3: 12
4: 185
Right 966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG 0: 1
1: 0
2: 1
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966435874 Original CRISPR TTAGTTCAGCTAATCTATTT TGG Intronic
901460756 1:9390053-9390075 TTAGTTCACCTGATCTAATGTGG + Intergenic
904635988 1:31881957-31881979 TTACTTAAGCCAATCAATTTGGG - Intergenic
905965220 1:42087342-42087364 TTAATTCAGTTAATGAATTTTGG + Intergenic
906833072 1:49054474-49054496 TTAAATCAGCAAACCTATTTTGG + Intronic
908230964 1:62104553-62104575 TTAATTCATCTAGTGTATTTAGG - Intronic
910869750 1:91822435-91822457 TCAGCACATCTAATCTATTTTGG + Intronic
914378408 1:147093869-147093891 TTATTTTACCTATTCTATTTAGG + Intergenic
918574703 1:186043701-186043723 TGAAATCAGCTATTCTATTTTGG + Intronic
920134708 1:203760355-203760377 GCAGTTCATCTAATCTTTTTGGG - Intergenic
1067676589 10:48384874-48384896 TTAATACAGATAATGTATTTGGG + Intronic
1068211731 10:53929123-53929145 TCAGTTCAGCAAACCAATTTGGG + Intronic
1069290235 10:66769906-66769928 TTAGTGCAGGTCATTTATTTAGG - Intronic
1070598350 10:77848436-77848458 TAGGTCCTGCTAATCTATTTGGG - Intronic
1074342646 10:112648813-112648835 GTTGATCAGGTAATCTATTTAGG - Intronic
1074935278 10:118172376-118172398 TTAGTCCAGATAATTTTTTTGGG - Intergenic
1077719768 11:4616167-4616189 TTAGTTCAAGTAGTTTATTTGGG - Intergenic
1077975351 11:7242494-7242516 TTATATGAGCTAATATATTTAGG + Intronic
1079979400 11:27133009-27133031 TTAGTTCAGGTTTTCTTTTTAGG - Intergenic
1084145781 11:67264665-67264687 TTTGTTCACCTAATCTGCTTTGG + Intergenic
1085002539 11:73053605-73053627 TTAGTTTATCTAATCTAGGTTGG - Intronic
1085369600 11:75988177-75988199 TGAGTTTAGCTAATGTATTCAGG + Intronic
1086279236 11:85166607-85166629 TTAGTCCACCTGATCTCTTTAGG + Intronic
1086408043 11:86516198-86516220 TTACTTCAGGGAATCAATTTTGG + Intronic
1086666294 11:89487995-89488017 TTAATTTATCTAAGCTATTTTGG - Intronic
1091512431 12:1142284-1142306 TTTTTTCAGTTAATATATTTTGG + Intronic
1092322593 12:7493423-7493445 TTACTGCAGCAAATCTATTCTGG + Intronic
1094102037 12:26775096-26775118 TTGGTAGAGGTAATCTATTTGGG - Intronic
1095591979 12:43913965-43913987 TTAGTTCTGTTAATGTTTTTGGG + Intronic
1095843346 12:46718881-46718903 TGAGTTCATCTTATCAATTTGGG - Intergenic
1097520689 12:60666688-60666710 TTAGTTTAGCTAATAGTTTTTGG + Intergenic
1097789205 12:63796238-63796260 TCAGTTCAGGTTATGTATTTTGG + Intronic
1098017555 12:66121909-66121931 ATAATTCAGCTACTGTATTTAGG + Exonic
1099562805 12:84199276-84199298 TAACTTCAGCTAATCAATTGAGG - Intergenic
1099964788 12:89434133-89434155 TTAATTCAGCAAATTTAGTTTGG - Intronic
1101578561 12:106020535-106020557 TTATCTCAGATAATGTATTTGGG - Intergenic
1108067176 13:46590068-46590090 TTAGTTCAGTTAATCTTTTTTGG + Intronic
1109669022 13:65580310-65580332 TTATTTCTTCTAATTTATTTTGG - Intergenic
1109695199 13:65946686-65946708 TGAGTTCAGCTACTCTTATTTGG + Intergenic
1109925750 13:69136415-69136437 GTATTTCAGCTTATATATTTTGG + Intergenic
1110582085 13:77142324-77142346 TTAGTTCAGCAAATGTTTTTTGG - Intronic
1110685390 13:78366936-78366958 TTACTTCAGCAAATTTATTGAGG - Intergenic
1113145689 13:107204603-107204625 TTATTTCAGTTAATATCTTTAGG - Intronic
1117770942 14:59134146-59134168 TTAGTGCAGCTACTCCATGTTGG - Intergenic
1122086314 14:99308815-99308837 GTAATTGAGCTAATGTATTTTGG - Intergenic
1124821285 15:33048220-33048242 ATTGTTCAGTTAACCTATTTTGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1131662842 15:94537219-94537241 TTAATTCACGTAATGTATTTAGG + Intergenic
1135850762 16:25961151-25961173 TCTCTTCAGCTAATCTATTACGG + Intronic
1137312431 16:47277872-47277894 TTATTTCAGCTATTATATTTGGG + Intronic
1144005941 17:11099336-11099358 TTAGCAAAGCTAATCTATTGTGG + Intergenic
1148001188 17:44388301-44388323 TTAGTTCTGCAAATCAATTTAGG + Intronic
1149572044 17:57678794-57678816 TGAGCTCACCTAATCCATTTTGG - Intronic
1150921018 17:69482566-69482588 TTATTTCACTTAATGTATTTTGG + Intronic
1151366447 17:73619606-73619628 ATGGTTCAGCTCTTCTATTTTGG - Intronic
1153153302 18:2120584-2120606 TTTATTCAGCCAGTCTATTTTGG + Intergenic
1154212601 18:12392840-12392862 TTACTTCAGCAATTCTATGTAGG + Intergenic
1155722324 18:29031264-29031286 TGTGTTCATTTAATCTATTTGGG - Intergenic
1156256756 18:35405452-35405474 GTAGTCCAGTTTATCTATTTTGG - Intergenic
1158149826 18:54355901-54355923 TTAGTACAGCTATATTATTTTGG + Intronic
1166082889 19:40455722-40455744 TTTGTTCTCCTAAACTATTTGGG - Intronic
925296682 2:2781621-2781643 TGAGTTCAGCAAATCTTTGTGGG - Intergenic
927659204 2:24978450-24978472 TTTTTTCAGTTAATATATTTAGG + Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
929918678 2:46156725-46156747 TTTGTTCAGTTTATATATTTAGG + Intronic
931110521 2:59105801-59105823 TTATTTCAGCTAATAGAATTAGG + Intergenic
931554437 2:63485878-63485900 TTATTTCAGCAAATGAATTTGGG + Intronic
933096159 2:78184030-78184052 TATGTTCAACTAATTTATTTTGG + Intergenic
933224422 2:79729134-79729156 TGAGTTCAATTAATCTCTTTGGG - Intronic
935383764 2:102479727-102479749 TTATTTCACCTAATCTAATGTGG - Intronic
937464127 2:122115052-122115074 TTTGTTCTGTTAATCTCTTTAGG + Intergenic
941711345 2:168717256-168717278 TCATTTCAACTAATCCATTTAGG - Intronic
942502749 2:176608598-176608620 TTAGTTCAGCAAAGCAATTGAGG - Intergenic
942582927 2:177440398-177440420 TAAGTTCAGGTTATATATTTTGG - Intronic
943174086 2:184446654-184446676 TTATTTTTGCTAATCTATTTTGG + Intergenic
943317468 2:186408145-186408167 TTAGATTATATAATCTATTTAGG - Intergenic
944489463 2:200243224-200243246 TTTGTAGAGCTAATCTAGTTTGG - Intergenic
944647171 2:201791670-201791692 TTAATTCAGCTATTCTAAGTGGG + Intronic
945328418 2:208511044-208511066 TTAATGCAACTAATTTATTTTGG + Intronic
945765738 2:213975040-213975062 TTATTTTATCTAATCTATTGAGG - Intronic
946477916 2:220026688-220026710 AAAGTTCAGCTATTCCATTTAGG + Intergenic
1168982611 20:2020786-2020808 TCAGTTCACTTAATCTATTTCGG + Intergenic
1170435131 20:16318647-16318669 TTTATTCAGTTATTCTATTTTGG - Intronic
1172222389 20:33282882-33282904 TTAATCCAGATAATCAATTTGGG - Intronic
1182194261 22:28498414-28498436 TAAGTTGAGATAAACTATTTTGG + Intronic
1182635664 22:31724784-31724806 TTACCTCAGCTACTCTCTTTTGG + Intronic
1182818602 22:33191772-33191794 TTAGTTCCTGTAATGTATTTTGG - Intronic
952584947 3:34880329-34880351 TTATTTCAGCTAATCTACACTGG + Intergenic
952915504 3:38236328-38236350 TCATTTTAGCTAATCTTTTTTGG - Intronic
953091840 3:39735389-39735411 TTATTTCAGCTAACTTTTTTTGG - Intergenic
953250402 3:41241013-41241035 TTAGTTCATCTCATCTCTTCAGG + Intronic
953285914 3:41609266-41609288 TTAGTTCAGCCCATTTATTCAGG + Intronic
953535532 3:43774208-43774230 TCAGTTCATCTAATCACTTTTGG + Intergenic
954214062 3:49114710-49114732 CTAGTTCAGCTCAGCTATTCTGG - Intronic
957507634 3:81144510-81144532 TTAGTTTGCATAATCTATTTAGG - Intergenic
960208582 3:114932669-114932691 TTAGTACAAATAATTTATTTTGG + Intronic
960429069 3:117546692-117546714 TTAGAGCAGCTAATGCATTTTGG + Intergenic
962176311 3:133159281-133159303 CTAGTTTTGCTAATCTAGTTAGG + Intronic
963172883 3:142268746-142268768 TGAGTTTAGCTAAACCATTTTGG + Intergenic
965275902 3:166682116-166682138 TCACTTCAGCTAATGCATTTAGG + Intergenic
965364456 3:167781470-167781492 TTTGTTCTGCTAATATATTGGGG - Intronic
965432376 3:168605540-168605562 TTATTTCAGAGAATTTATTTGGG + Intergenic
966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG + Intronic
968182606 3:196607674-196607696 TTAGTTCTGCTTTTCTTTTTGGG - Intergenic
969555542 4:7906483-7906505 TGAGTCCAGCCAATGTATTTGGG + Intronic
970913356 4:21305056-21305078 ATTGTGGAGCTAATCTATTTGGG - Intronic
972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG + Intronic
972876895 4:43373416-43373438 TTAGTTCAGGCAATCTGTTAGGG + Intergenic
973152169 4:46901681-46901703 TTACGTCAGCCAATCTATTGGGG + Intronic
973219748 4:47711664-47711686 TTATTTAAGCCACTCTATTTTGG + Intronic
974404017 4:61442155-61442177 TTAGTTCAAGTAAAATATTTTGG + Intronic
975487544 4:74950572-74950594 GTGGTTCAGCTTATCTTTTTGGG + Intronic
977569989 4:98619187-98619209 TTAATTCTGCTTATCTCTTTTGG + Intronic
981695905 4:147558488-147558510 TTACTGTAGATAATCTATTTTGG - Intergenic
982307490 4:153948004-153948026 TTGGTTCGTCTAATATATTTAGG + Intergenic
983727722 4:170949752-170949774 TTAGGTCAGCTTATCTCTATGGG + Intergenic
984030295 4:174596114-174596136 TGGGTTCAGCTAGTATATTTTGG - Intergenic
986336660 5:6760426-6760448 TCAGTACAGCTCCTCTATTTTGG + Intergenic
987138863 5:14925444-14925466 TTAGCTCAGCTAAGCAATATTGG - Intergenic
987631039 5:20471973-20471995 TCAGTTCAGTGAATTTATTTTGG - Intronic
987771310 5:22309137-22309159 TTAACTCAGCTAATATATTGAGG + Intronic
990054420 5:51553490-51553512 TTAGTTCTGCAATTTTATTTTGG - Intergenic
990926239 5:61027714-61027736 ATAGTTAAGCTAATATATTTTGG - Intronic
993818822 5:92588297-92588319 GTAATTCAGCTAATCAATTAAGG + Intergenic
994221224 5:97197542-97197564 TTATTTGAGCTATTATATTTTGG + Intergenic
994252666 5:97555326-97555348 TTAGTTCAACTAATTTGTCTGGG - Intergenic
995056138 5:107761143-107761165 TTAGTTCAGACAAATTATTTTGG + Intergenic
997015487 5:129929428-129929450 TTCTTTCAGCTATACTATTTAGG + Intronic
997789184 5:136741861-136741883 TTAGTTTAGCTTCTTTATTTTGG + Intergenic
1000532913 5:162445561-162445583 TTCTTTTAGCCAATCTATTTTGG + Intergenic
1003579195 6:7324293-7324315 TGAGTTCAGATAACCTACTTAGG + Intronic
1004543107 6:16570293-16570315 TTATTCCTTCTAATCTATTTGGG + Intronic
1005382225 6:25247604-25247626 TTATTTAAGCCACTCTATTTTGG + Intergenic
1005687929 6:28273030-28273052 TTTGTTCAGCTAAAATATTTGGG - Intronic
1008266556 6:49434882-49434904 TTATTTAAGCTAATCTGATTAGG - Intronic
1008929993 6:56928893-56928915 TTAGTTCAACTCTTCTTTTTTGG - Intronic
1009530395 6:64805005-64805027 TTAATTCAGCAAATATTTTTTGG - Intronic
1014243705 6:119044811-119044833 TTAGTTTATCTCATCTATGTTGG + Intronic
1015000843 6:128213162-128213184 TTATTTCAGATAGTATATTTTGG - Intronic
1015235162 6:130962488-130962510 TTAGTTCATATTATCTATATGGG + Intronic
1020849257 7:13329758-13329780 TTAGTTATGCACATCTATTTAGG - Intergenic
1021214238 7:17896661-17896683 TCATTTCAACTAAGCTATTTTGG + Intronic
1021920911 7:25483990-25484012 TCAGTGCAGCTGATCTTTTTTGG - Intergenic
1022756378 7:33296159-33296181 TCAGTTTAAGTAATCTATTTTGG - Intronic
1022801641 7:33782437-33782459 TCAGTTCAGCTCATCTAGTCTGG + Intergenic
1024443187 7:49445606-49445628 TTATTTTAGCTAATATATTTAGG + Intergenic
1024823122 7:53357431-53357453 ATAGTTTAGCTAATATATATTGG - Intergenic
1028472994 7:91224550-91224572 TCAGCTCTGCTAATCTCTTTTGG - Intergenic
1031159419 7:118148493-118148515 TTAGTACAGGTAGTTTATTTGGG + Intergenic
1031307025 7:120141479-120141501 TTATTTCAAAAAATCTATTTCGG - Intergenic
1032950310 7:136901509-136901531 TGAGATCTGCTAATCTGTTTGGG - Intronic
1034100242 7:148444693-148444715 TGTGTCTAGCTAATCTATTTGGG - Intergenic
1034100250 7:148444809-148444831 TGTGTCTAGCTAATCTATTTGGG - Intergenic
1035343624 7:158182703-158182725 TTTCTTCATCTACTCTATTTTGG + Intronic
1037005175 8:13769309-13769331 TAAGTTCAGTTCATTTATTTAGG - Intergenic
1037159568 8:15751732-15751754 TTAATTCAGTTCATGTATTTGGG + Intronic
1037613515 8:20496279-20496301 TGAGTTCAGCTTATGAATTTGGG - Intergenic
1038678170 8:29642519-29642541 TTAGTTCAGCTGGTCTCTGTGGG - Intergenic
1038695294 8:29801092-29801114 TTGGTTCAGAGAATATATTTTGG - Intergenic
1040608713 8:48961302-48961324 TTGGTGCAGGTAATTTATTTGGG + Intergenic
1040869431 8:52085020-52085042 TTAGTTTAGCTGAAATATTTGGG + Intergenic
1041823005 8:62061263-62061285 TTAGTTGTGCAAATATATTTAGG - Intergenic
1043361288 8:79475405-79475427 TTGGTTCCGCTAATCCTTTTAGG - Intergenic
1044215260 8:89601647-89601669 TTATTTTAGCTAATGTTTTTAGG - Intergenic
1048920171 8:139222218-139222240 TCAGTTCATGAAATCTATTTAGG - Intergenic
1049010699 8:139885145-139885167 TTTAATCAGCTCATCTATTTTGG - Intronic
1051075158 9:13224696-13224718 TTAATCCAGCAATTCTATTTTGG + Intronic
1051601906 9:18883223-18883245 TTAGTTCAGCTGATCTAAGCTGG + Intronic
1052089471 9:24310432-24310454 TTAGTAAAGCTAATGGATTTTGG - Intergenic
1052676907 9:31637957-31637979 GTAGTTAGGCTAAACTATTTTGG - Intergenic
1053194429 9:36105111-36105133 TTGGTTAAACTAATCTGTTTTGG + Intronic
1058501847 9:105627322-105627344 GTAGTTCAGTTTATCTATTATGG + Intronic
1059394026 9:114019519-114019541 TTAATTCAGCTATTCTAGTGAGG + Intronic
1060169606 9:121450708-121450730 GTGGTTCACCTAATCTAATTAGG + Intergenic
1186632543 X:11365590-11365612 TTTGTTCTGCTTTTCTATTTTGG - Intronic
1186641228 X:11457932-11457954 TGAGTTCAGGTAGTTTATTTGGG - Intronic
1188090236 X:25954801-25954823 TTTGTTCACATAATCAATTTTGG - Intergenic
1194070355 X:89316867-89316889 TTTCTTCATCTATTCTATTTTGG - Intergenic
1195641574 X:107181249-107181271 TTTTTTCAGTTAATCTTTTTAGG + Intronic
1198109663 X:133491873-133491895 TTAGTTCAGCTGTTCACTTTTGG + Intergenic
1198323725 X:135545589-135545611 TGAGTACAGCTAATTTATTTTGG + Intronic
1198392093 X:136186471-136186493 TTAGTGCTGCTGATCTCTTTTGG + Intronic
1200724594 Y:6652491-6652513 TTTCTTCATCTATTCTATTTTGG - Intergenic
1200947497 Y:8860425-8860447 TTATTTCATATAATCTAGTTTGG + Intergenic
1201849934 Y:18468351-18468373 TTAGTTTATATAATCTACTTCGG - Intergenic
1201883384 Y:18852024-18852046 TTAGTTTATATAATCTACTTCGG + Intergenic
1202333788 Y:23783719-23783741 TTAGTTTCTATAATCTATTTTGG + Intergenic
1202536982 Y:25886344-25886366 TTAGTTTCTATAATCTATTTTGG - Intergenic