ID: 966435976

View in Genome Browser
Species Human (GRCh38)
Location 3:179884395-179884417
Sequence CTGCTTTTGAAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1284
Summary {0: 1, 1: 3, 2: 35, 3: 335, 4: 910}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966435974_966435976 -2 Left 966435974 3:179884374-179884396 CCAATGTGAGAGAGAGAGCTGCT 0: 1
1: 0
2: 0
3: 26
4: 280
Right 966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG 0: 1
1: 3
2: 35
3: 335
4: 910
966435973_966435976 17 Left 966435973 3:179884355-179884377 CCAGAGAAGGACATGGAGACCAA 0: 1
1: 1
2: 2
3: 29
4: 315
Right 966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG 0: 1
1: 3
2: 35
3: 335
4: 910

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966435976 Original CRISPR CTGCTTTTGAAGATGGAGCA AGG Intronic
900566296 1:3333701-3333723 CTGATTTTGGAGGTGGAGCTTGG + Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900783354 1:4632056-4632078 CTGGCTTTGAAGACGGAGGAGGG - Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
900910255 1:5592334-5592356 TGACTTTTGAAGATGGAGTAAGG + Intergenic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
900952507 1:5865845-5865867 GTGCTTCTGAGGATGGGGCAGGG - Intronic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
901107484 1:6768426-6768448 CAGCTTGTGAAGATGCAGCCAGG + Intergenic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901826031 1:11861936-11861958 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903677870 1:25076046-25076068 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
904007263 1:27369914-27369936 CTGCTTTGGAAGAGGAACCACGG - Intronic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904416205 1:30362472-30362494 CTGCTGTTGACCATCGAGCAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904956289 1:34286824-34286846 CTACTTTGGAAGGTGGAGAAGGG - Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905497481 1:38403950-38403972 CTGCTTTTGTGGAGGTAGCAGGG - Intergenic
905526355 1:38642943-38642965 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
905737965 1:40343767-40343789 CTAACTTTGAAGATGGAGGAAGG - Intergenic
907380038 1:54079565-54079587 CAAGTTTTGAAGATGGAGGAAGG - Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
907653041 1:56314335-56314357 CTGGTGTTGTAGATGGAGGAAGG + Intergenic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
907933094 1:59018349-59018371 CTGACTTTGAAGATGAAGGAAGG + Intergenic
908022202 1:59909483-59909505 CTGGCTTTGAAGATGAAGGAGGG + Intronic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908127453 1:61045122-61045144 CTGCTCTTGATCATGGAGGATGG - Intronic
908269697 1:62410952-62410974 CTGTCTTTGAAAATGGAGAAAGG - Intergenic
908709739 1:67001776-67001798 CAGCATTGCAAGATGGAGCAGGG - Exonic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
908871891 1:68622622-68622644 CTGAGTTTGAAGATAGAGGAAGG - Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909072848 1:71017275-71017297 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
909128145 1:71701400-71701422 CTGGTTTGGAAAATGGAGAAAGG - Intronic
909369506 1:74867699-74867721 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
909748005 1:79123137-79123159 CTGGTTTTGAAGATGGCAGAAGG - Intergenic
909979570 1:82082611-82082633 CTAGTTTTGAAGATGGAGGAAGG - Intergenic
910047572 1:82936388-82936410 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910158801 1:84251718-84251740 TTGGTTTTCAAGATGGAGGAAGG + Intergenic
910205170 1:84742531-84742553 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
910207800 1:84765205-84765227 TTGACTTTGAAGATGGAGGAAGG - Intergenic
910393428 1:86767957-86767979 CTGGTTTTGAAGAAGTAGGAAGG - Intergenic
910400438 1:86832705-86832727 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
910980059 1:92951253-92951275 CTGGCTTTGAAGTTGGAGAAAGG + Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911351233 1:96758359-96758381 CTGTCTTTGAAAATGGAGGAGGG + Intronic
911478250 1:98401050-98401072 GTGGTTTTGAAGATGAAGGAAGG + Intergenic
911704606 1:100997002-100997024 CTGCTTTTGTTAATGGAGCAAGG + Intronic
912015760 1:105033500-105033522 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
912024542 1:105151481-105151503 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
912336021 1:108863639-108863661 TTGCTTTTGAAGATGAAGGAAGG - Intronic
912465638 1:109871579-109871601 CTGGTTTTGAAGACGGAGAAAGG + Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913989007 1:143592376-143592398 CTGCATTTGAAGTAGGAGGATGG + Intergenic
914050115 1:144124457-144124479 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
914129067 1:144840994-144841016 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916267045 1:162901009-162901031 CTGGCTTTGGAGATGGAGAAAGG - Intergenic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916777712 1:167985412-167985434 CTGGGTTTGAAGATAGAGGAAGG - Intronic
916807949 1:168278560-168278582 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
916908441 1:169316687-169316709 GTGGCTTTGAAGATGGAGAAAGG + Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917196231 1:172468812-172468834 CTGTTTATGAAAATGGAACATGG + Exonic
917560014 1:176141199-176141221 CTGATTTTAAAAATCGAGCAAGG + Intronic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918080711 1:181205982-181206004 CTGCTTGTGAACTTGCAGCACGG - Intergenic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
918442054 1:184577292-184577314 CTGGCGTTGAAGATGGAGAAAGG + Intronic
919013840 1:192002269-192002291 CTGGTTTTGAAGATAAAGGAAGG - Intergenic
919019036 1:192079857-192079879 CTGCCTTTGAAGGTGGAAGAAGG - Intergenic
919482786 1:198109885-198109907 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919538552 1:198819686-198819708 CTGGTTTTGAAGATGAAGAAAGG - Intergenic
919588882 1:199474274-199474296 ATGGTTTTGAAGATGGAAAAAGG - Intergenic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
920411011 1:205760841-205760863 TGGCTTTTGAAGATGAAGAAAGG + Intergenic
920521602 1:206631658-206631680 TTGGTCTTGAAGATGGAGGAGGG - Intergenic
920535758 1:206735642-206735664 TTGCGGTTGAAGATGGAGAAAGG - Intergenic
921151584 1:212407253-212407275 CTGGTTTTGAAGCTGCAGGAAGG + Intronic
921412446 1:214850232-214850254 CTGCCTTTGAAGATAGAGGATGG + Intergenic
922101810 1:222483217-222483239 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
922262892 1:223958338-223958360 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
922996460 1:229966151-229966173 CTGGCTTTGAAGGTGGAGAAAGG + Intergenic
923195698 1:231664593-231664615 CTGCTTTTGAAGATGGAGAAAGG + Intronic
923436516 1:233972466-233972488 CTGCTATAGAAGGTGGAGCTAGG - Intronic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
924213103 1:241790976-241790998 CTGGCTTTGAAGATGAAGGAAGG - Intronic
924344730 1:243063339-243063361 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
924530353 1:244888641-244888663 CTGGCTTTGAACATGGAGGAAGG + Intergenic
924718309 1:246599453-246599475 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1063091227 10:2867632-2867654 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1063894004 10:10660027-10660049 CTGGCTTTGAAGATAGAGAAAGG + Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064355863 10:14617321-14617343 TTGCACTTGAAGGTGGAGCAGGG + Intronic
1065400925 10:25300287-25300309 CTGCCTTTGAAGCTGGAAGAAGG - Intronic
1065783697 10:29193616-29193638 CTGCTTTTGATGCTGGAGCTGGG - Intergenic
1065794738 10:29295797-29295819 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1065947997 10:30624934-30624956 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1066282319 10:33929753-33929775 CTGCTTTAGATGATTGAGAAAGG - Intergenic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1067454250 10:46404938-46404960 CTGCCTTTGAGGATGGAGGAAGG - Intergenic
1067632953 10:47979694-47979716 CTGCCTTTGAGGATGGAGGAAGG + Intergenic
1067781487 10:49210739-49210761 ATGCTTTTGAAGGTGAAGGATGG - Intergenic
1067843359 10:49699577-49699599 CTGCTTCTGATCAAGGAGCATGG + Intronic
1067894145 10:50161548-50161570 TTGATTTTGAAGATGGATGAAGG - Intergenic
1067954700 10:50778713-50778735 TTGATTTTGAAGATGGATGAAGG + Intronic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068286159 10:54938868-54938890 CTGGCTTTGAAAATGGAGAAAGG + Intronic
1068780755 10:60916934-60916956 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070425616 10:76284349-76284371 GTGCTTTTGAAAATGGAGCCAGG + Intronic
1070472424 10:76796004-76796026 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1070658522 10:78288093-78288115 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071231725 10:83595917-83595939 CTGCTTCTGAAGGTGAGGCATGG - Intergenic
1071309020 10:84326210-84326232 CAGGTTTTGAAGATGGAGGAAGG + Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071805616 10:89117279-89117301 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072169594 10:92846976-92846998 CTAGCTTTGAAGATGGAGGAAGG + Intronic
1072578693 10:96721765-96721787 CTGGCTTTGAAGATAGAACAAGG - Intergenic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1072911889 10:99509497-99509519 CTGGCTTTGAAGATGGAGGCAGG + Intergenic
1073080293 10:100855530-100855552 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1073179703 10:101576226-101576248 CTGGCTTTGAAGATGGGGAAAGG - Intronic
1073604363 10:104879334-104879356 TTGCCTTTGAAGATGGAGACAGG - Intronic
1073741301 10:106410172-106410194 CTGTTTTTGAAGATGGAAGCGGG + Intergenic
1074150334 10:110753846-110753868 CTGTCTTTGAGGATGGAGAAGGG - Intronic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074413889 10:113250310-113250332 CTGCGTTTGAAGCTGGATCCAGG - Intergenic
1074439026 10:113458846-113458868 TTGGTTTTGAAGATGGAAGAAGG - Intergenic
1074471007 10:113726705-113726727 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1074494038 10:113963434-113963456 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1074681071 10:115908407-115908429 CTAGTTTTGAAGATGCAGGAAGG - Intronic
1074702654 10:116106085-116106107 CTGGTTCTGAAAATGGAGGAAGG + Intronic
1074889436 10:117722843-117722865 CTCCTTTTGCAGATGGTGAAAGG + Intergenic
1075029117 10:119009321-119009343 CTGGCTTTGAAGATGGAGTTGGG + Intergenic
1075059627 10:119246764-119246786 CTGCTTTGGAAGGTGCAGGAGGG - Intronic
1075068819 10:119307512-119307534 CTGGTTTTGAAGGTGGAGGAAGG + Intronic
1075112522 10:119598613-119598635 CTTTTCTTGAAGATGGAGGATGG - Intergenic
1075264362 10:120988202-120988224 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075393540 10:122110993-122111015 CTGACTTTGAAGATGAAGGAAGG - Intronic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1075515653 10:123106044-123106066 CTGGCTTTGAAGATGCAGGATGG + Intergenic
1075580066 10:123610727-123610749 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1075607225 10:123820746-123820768 CTGGCTTTGAAGATGGATAAAGG - Intronic
1075814017 10:125250480-125250502 AAGCTTTTGAAGATGAAGCTGGG + Intergenic
1075874361 10:125794207-125794229 CCAGTTTTAAAGATGGAGCACGG - Intronic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076094672 10:127721257-127721279 CTGCTTTGGAAAAGGGAGGAAGG + Intergenic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1077290301 11:1786636-1786658 CTGGCTTTGAAGATGGAGGTGGG - Intergenic
1077482434 11:2822101-2822123 CTGGCTTTGAAGACGGAGGAGGG + Intronic
1078565345 11:12409599-12409621 CTGGCTTTTAAGATGGAGTAAGG + Intronic
1078622047 11:12917234-12917256 CTGGCTTTGAAAATGGAGCAAGG + Intronic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079946671 11:26751540-26751562 GTGGCTTTGAAGATGGAGAAAGG + Intergenic
1079986575 11:27206449-27206471 CTAATTTTGATGATGGAGGAAGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080615158 11:33939345-33939367 CTGACTTTGAAGCTGGAGGAAGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081026412 11:38019963-38019985 CTGTTCTTGAAGAGGGGGCAAGG - Intergenic
1081350534 11:42046314-42046336 CCGCCTTTGAAGATGGACAAAGG + Intergenic
1081844896 11:46233282-46233304 CTGGTTTTGAAGACAGAGGAAGG + Intergenic
1082262148 11:50084731-50084753 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1082569636 11:54722350-54722372 CTAGTTTTGAAGATGGAAGAGGG + Intergenic
1082570683 11:54734849-54734871 CTACTTTTGATGATGGAAGAGGG + Intergenic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1083313776 11:61801626-61801648 CTGCTTCTGAAACTGGAGAATGG + Exonic
1083402105 11:62430685-62430707 CTGACTTTGAAGATGGGGAAGGG - Intergenic
1083641509 11:64148218-64148240 CAGCTTTTCAGGATGGAGGAGGG + Intronic
1084270157 11:68024986-68025008 CTGCTTCTGGAGTTGGAGCAGGG - Intronic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1087332930 11:96805619-96805641 CTGGCTTTGAAGACGGAGGATGG - Intergenic
1087351304 11:97036046-97036068 CTGGTTTTGAAGATTGAGTAAGG + Intergenic
1087430419 11:98046499-98046521 CTGGCATTTAAGATGGAGCACGG + Intergenic
1087463389 11:98473178-98473200 CTGGCTTTGATGATGGAGGAAGG - Intergenic
1087956974 11:104300430-104300452 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1088572520 11:111236818-111236840 CTGCCTTTGAAGATTGAAGAAGG - Intergenic
1088680061 11:112232309-112232331 CTGGGATTGAAGATGAAGCAAGG + Intronic
1088706075 11:112465871-112465893 TTGTGTTTGTAGATGGAGCAAGG + Intergenic
1088936108 11:114401565-114401587 CTTCTTTTGAAAATGATGCACGG - Intronic
1088966560 11:114728069-114728091 CTGATTTTGAACATGGAGGACGG - Intergenic
1088968693 11:114751922-114751944 ATGGCTTTGAAGATGGAGAATGG + Intergenic
1089068815 11:115682718-115682740 CTGGCTTGGAAGATGGAGGAAGG + Intergenic
1089159814 11:116428741-116428763 CAGTTTCTGAAGATGGAGCTCGG + Intergenic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1089949566 11:122512672-122512694 GTGACTTTGAAGATGGAGGAAGG - Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1091312142 11:134582163-134582185 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1091424790 12:378077-378099 CTACTGTTAAAGATGGAGAATGG - Intronic
1092001576 12:5036988-5037010 CTGGCTTTGATGATGGAGGAGGG + Intergenic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1093719186 12:22418678-22418700 CTGGTTTTGAAGATGGAGGGAGG + Intronic
1093719685 12:22425318-22425340 CTGGTTTTGAAGACGGAGGGAGG + Intronic
1094455146 12:30623838-30623860 CTGATTTTGAAGACGGAGGAAGG - Intergenic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1095136808 12:38614983-38615005 CTGGTTTTGATGATGGAAAAGGG - Intergenic
1095482370 12:42649789-42649811 CTGCCTTAGAAGCTGGGGCATGG + Intergenic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097527736 12:60759388-60759410 CTAGCTTTGAAGATGGAGAAGGG - Intergenic
1097583944 12:61492729-61492751 CTGGCTTTGAAGATGGAACAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098546373 12:71716353-71716375 CTGGTTTTGAAGACGGAGGCAGG + Intergenic
1098638610 12:72814065-72814087 CTGACTTTGAAAATGGAGGAAGG - Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099182557 12:79485014-79485036 TTGGCTTTGAAGATGGAGCAAGG - Intergenic
1099293454 12:80801384-80801406 CTCGTTTTGAAGATGGAGGAAGG + Intronic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1099610347 12:84859908-84859930 TTGCCTTTAAAGATGGAGAATGG + Exonic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1099811424 12:87587322-87587344 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1100021013 12:90069711-90069733 CTGCTATTGAAAATGGAAAAAGG + Intergenic
1100347258 12:93744354-93744376 CTGCCTTTGAAGATGTAGATGGG - Intronic
1100397412 12:94197088-94197110 TTGGTTTTGAAGATGCAGGAAGG - Intronic
1100588699 12:96003769-96003791 CTCCTTTGAAAGATGGAGAAAGG - Intronic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1100874008 12:98943567-98943589 ATGGTCTTGAAGATGGAGGAAGG - Intronic
1101407708 12:104443271-104443293 GTGGCTTTGAAGATGGAGGATGG + Intergenic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102427729 12:112857508-112857530 CTGGTTTTGAAAAGGGAGGAAGG + Intronic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102814208 12:115849886-115849908 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1102991632 12:117320378-117320400 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103137902 12:118523558-118523580 CTAGATTTGAAGATGGAGAAAGG + Intergenic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1103951354 12:124553155-124553177 CTGGCTTTGAGGATGGAGAAGGG - Intronic
1103994678 12:124821410-124821432 CTGGTTCTGAAGATGAATCAGGG + Intronic
1104053982 12:125215440-125215462 CTGGCTTTGAAGATGAAGAAGGG - Intronic
1104074783 12:125379365-125379387 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104218321 12:126756873-126756895 CTGCCTTTGATGATGGAGAAAGG - Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1104533220 12:129592755-129592777 ACGTTTGTGAAGATGGAGCAAGG + Intronic
1106155812 13:27154898-27154920 CTGGCTTTGAAGATGCTGCAGGG + Intronic
1106273815 13:28183442-28183464 CCGCTTGTCAAGATGGAGGAGGG + Intronic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106670652 13:31901056-31901078 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1107366248 13:39680741-39680763 CTGGCTTGGAAGATGGAGGAAGG - Intronic
1107691775 13:42960775-42960797 CTGGCTTTGAAGATGTAGGAAGG - Intronic
1107788367 13:43976801-43976823 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1108149428 13:47517176-47517198 CTGACTTTGAACATGGAGGAAGG - Intergenic
1108268277 13:48733696-48733718 CTGGCTTTGAAAATGGAGAAGGG + Intergenic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1109706144 13:66095013-66095035 CTGGTTTCGAAGATGGAAGAAGG + Intergenic
1110068026 13:71133533-71133555 CTGGTTTTCAAGATGGAGGTAGG + Intergenic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110409221 13:75185480-75185502 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110442311 13:75539034-75539056 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1110731013 13:78878183-78878205 CAGGTCTTGAAGATGGAGGAAGG - Intergenic
1110837525 13:80101599-80101621 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110838303 13:80110423-80110445 CTGGCTTGGAAGATGGAGTAAGG + Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1111574728 13:90137683-90137705 CTGTCTTTGAAGATGAAGAAAGG + Intergenic
1111741833 13:92214886-92214908 CTGGTTTTGAAGACAGAGGAAGG + Intronic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1112927429 13:104693823-104693845 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113096284 13:106667219-106667241 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113343975 13:109455713-109455735 CTGGCTTTCAAGATGGAGAAAGG - Intergenic
1113423818 13:110191174-110191196 CTGCTTTTGAAGTTAGATCTTGG - Intronic
1113506022 13:110816518-110816540 TTGCCTTTAAAGAAGGAGCAGGG - Intergenic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1114345915 14:21794905-21794927 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1114389072 14:22286407-22286429 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
1114951983 14:27766120-27766142 CTGCCTTTGAAGACGGAAAAGGG + Intergenic
1115312556 14:31994087-31994109 CTGTTTTTGAGCATGGAGCCTGG - Intergenic
1115495710 14:34002418-34002440 CTGGCTTTGACGATGGAGGAAGG + Intronic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1116001898 14:39252359-39252381 CTGGCTTTGAAAATGGAGGATGG + Intronic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1116739739 14:48739272-48739294 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
1116968314 14:51038242-51038264 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1117152270 14:52901617-52901639 CTGGCTTTGAAGATAGAGGAAGG + Intronic
1117380998 14:55162769-55162791 TTGCCTTTGAAGAAAGAGCAAGG - Intronic
1117814205 14:59580491-59580513 CTAGTTTTGAAGATGGAGGAAGG + Intergenic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118270933 14:64341439-64341461 CTAGTTTTAAAGATGGAGGAAGG + Intergenic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1119149263 14:72343317-72343339 CTGATTTTGAAAATAGAGGAAGG - Intronic
1119433170 14:74581508-74581530 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119510695 14:75208782-75208804 CTGACTTTGAAGATGGAGCGGGG + Intergenic
1120061496 14:79988719-79988741 CTGAGCTTGAAGATGGAGAAAGG - Intergenic
1120113730 14:80589096-80589118 CTGATTTTGAATATAGAGGAAGG + Intronic
1120219816 14:81719488-81719510 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120655255 14:87181510-87181532 AAGCTTTGAAAGATGGAGCACGG - Intergenic
1120834763 14:89029727-89029749 GGACTTTTGGAGATGGAGCAGGG - Intergenic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1122373183 14:101240630-101240652 CTGGCTTTGAAGACGGAGGATGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1122866777 14:104609449-104609471 CTGGCTTTGAAGATGGAGCAAGG - Intergenic
1123419978 15:20123720-20123742 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123529199 15:21130256-21130278 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123680455 15:22759084-22759106 CTGTTTTTGTAGATCGTGCAGGG + Intergenic
1123964358 15:25439541-25439563 CTGCCTTTGTAGATGTTGCAGGG + Intergenic
1124269349 15:28266570-28266592 CTTCTGTTGCAGATGGACCATGG - Intronic
1126318113 15:47392496-47392518 CTGGCTTTGAAGACGGAGGAAGG + Intronic
1126401280 15:48273269-48273291 CTGGCTTTGAAGATTGAGAAAGG - Intronic
1126424722 15:48515078-48515100 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1126466985 15:48969785-48969807 CTGCCTTTGGAGATGGAGGAAGG + Intergenic
1126729547 15:51668731-51668753 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127272679 15:57415425-57415447 CTGGCGTTGAAGATGGAGGAAGG + Intronic
1128087049 15:64893832-64893854 CCGCTTTTGAAGAGGGACCCGGG + Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128320999 15:66694208-66694230 CAGCTGTTGAAGATGAAGGAGGG - Intergenic
1128625729 15:69201009-69201031 CTGGCTTTGAAGATGAAGGAGGG - Intronic
1128934263 15:71731972-71731994 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1130959672 15:88651515-88651537 CTGGCTTTGAAGATGGAGGGAGG - Intronic
1131396224 15:92088694-92088716 CTGGCTTTGAAGATGGTGGATGG - Intronic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1131621096 15:94068904-94068926 CTAATTTTGAGGATGGAGGAAGG + Intergenic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1132028610 15:98422478-98422500 CTGCCATTGTAGGTGGAGCAGGG - Intergenic
1132029623 15:98429224-98429246 CTGGGTTTGAAGATGAAGGAAGG - Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1132414014 15:101607820-101607842 CTGCCTTTGAAGGCGGAGGAAGG + Intergenic
1132895133 16:2225291-2225313 GAGCTTTTGGAGATGGAGCTTGG + Intronic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133481263 16:6172979-6173001 CTGGCTTCGAAGATGGAGAAAGG - Intronic
1133518584 16:6533796-6533818 CTGCCTTTGAAAACTGAGCATGG + Intronic
1133534846 16:6691905-6691927 CTGGTTTTGAATATGGAGGAAGG + Intronic
1133625798 16:7569395-7569417 CTGATTTTGAAGATGGGGAAAGG - Intronic
1133738103 16:8630941-8630963 TGGCTTGTGAAGATGGAGCTGGG - Intronic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1134051516 16:11141013-11141035 CTGCTGTTGAGGAGGGAGCCAGG + Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134446127 16:14332877-14332899 CTGCTTGGGGAGATGGTGCAGGG + Intergenic
1134596067 16:15496958-15496980 CTGGCTTTGAACATGAAGCAAGG + Intronic
1134742229 16:16558121-16558143 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1134876552 16:17704983-17705005 CTGCCTTTGAAGATGGGTGAAGG + Intergenic
1134880418 16:17741124-17741146 TTTCTTTTGAAGGTGGACCAGGG - Intergenic
1134925335 16:18154335-18154357 CTGCCCTTGAAGATGGAGGAAGG - Intergenic
1135109818 16:19681853-19681875 CTGCTTTTGTGGTTGGAACAGGG + Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1136705710 16:32186819-32186841 CTGTTTTTGTAGATCGTGCACGG - Intergenic
1136762203 16:32742590-32742612 CTGTTTTTGTAGATCGTGCACGG + Intergenic
1136805896 16:33127796-33127818 CTGTTTTTGTAGATCGTGCACGG - Intergenic
1137449198 16:48555083-48555105 GGGCATTTGAAGAAGGAGCAAGG - Intronic
1137753000 16:50880449-50880471 CTGCTTTAGAGAATGGAGCTTGG + Intergenic
1137952389 16:52796042-52796064 CTGATTTTGAAGACAGAGGAAGG + Intergenic
1138639631 16:58374155-58374177 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1138649906 16:58453994-58454016 CTGGATTTGAAGATAGAGAAAGG - Intergenic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1139057141 16:63199489-63199511 CTGACTTTGAAGATGGAGAGAGG + Intergenic
1139309457 16:66016193-66016215 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1139374568 16:66488739-66488761 CTGGCTTTTAAGATGGAGGAAGG + Intronic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140127208 16:72128012-72128034 CTGCTTATGATGAGGGAGAAAGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140578751 16:76203445-76203467 CTAATTTTGAAGGTGGAGGAAGG - Intergenic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1140677068 16:77342939-77342961 CTGGCTTTGAAGATGAAGGAGGG + Intronic
1140700510 16:77577171-77577193 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140787062 16:78352480-78352502 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1140904411 16:79398144-79398166 TTTGATTTGAAGATGGAGCAAGG - Intergenic
1140937879 16:79691563-79691585 CTAGTTTTCAAGATGGAGAAAGG + Intergenic
1141035894 16:80625289-80625311 TTGCCTTTGATGATGGAGGAAGG - Intronic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141191073 16:81824975-81824997 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141317306 16:82974723-82974745 CTGTCTTTGAAGATAGAGGAAGG + Intronic
1141329980 16:83102094-83102116 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1141354684 16:83334098-83334120 CTGGCTTTGAGGATGGAGAAAGG - Intronic
1141372695 16:83502318-83502340 CTGGCTTTGAAGATGGAGCAAGG + Intronic
1141406037 16:83794013-83794035 CTGCCTCTGAAGATGAAGGAAGG + Intronic
1141471780 16:84243573-84243595 CAGGCTTTGAAGATGGAGAAGGG - Intergenic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1203064360 16_KI270728v1_random:1002907-1002929 CTGTTTTTGTAGATCGTGCACGG + Intergenic
1142687520 17:1586213-1586235 CTGAAGTTGAGGATGGAGCACGG + Intronic
1142718727 17:1762573-1762595 CTGATTTTGAAAAAGTAGCAGGG - Intronic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143564228 17:7711924-7711946 CTGCTTTTGTGGTTGGAGAATGG - Intergenic
1144217660 17:13070591-13070613 CTGGCTTTGAAGATGCAGAAAGG + Intergenic
1144515519 17:15915193-15915215 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1147008966 17:37428455-37428477 CTGGCTTTGAGGATGGAGAAAGG - Intronic
1147485129 17:40805444-40805466 CTGTCTTTGAAGATGAAGGATGG + Intergenic
1147503800 17:40993687-40993709 CTGCTTTAGAAATTGGAACAAGG - Exonic
1148132592 17:45270956-45270978 CTGCGGTGGCAGATGGAGCAAGG - Intronic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149375004 17:56034935-56034957 GTTGTTTTGAAGATGGAGAAAGG - Intergenic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1150303969 17:64068759-64068781 CTGCTATTGAAAATGGAAAAGGG + Intronic
1150310229 17:64122240-64122262 CTGCTCTGGAAGACAGAGCAGGG + Intronic
1151025488 17:70671749-70671771 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
1151139509 17:71977981-71978003 TTGGCTTTGAAGATGGAGAAGGG + Intergenic
1151189782 17:72389722-72389744 CTGGCTTTGAAGATGGTGGAAGG - Intergenic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1151364824 17:73610342-73610364 CAGCTTTTGAGCTTGGAGCAGGG - Intronic
1151656786 17:75499865-75499887 CTGAACCTGAAGATGGAGCAGGG + Exonic
1152172582 17:78762757-78762779 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153117665 18:1679135-1679157 CTGGCTTTGAAGATGGGGAAAGG - Intergenic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153327894 18:3840409-3840431 TTGGTTGTGAAGATGGAGAAAGG - Intronic
1153552883 18:6280818-6280840 CTAGTTTTGAAGATGGAGGAAGG + Intronic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1153904949 18:9652960-9652982 CTGATTTTGAAGATAGAGGAAGG - Intergenic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154206759 18:12344121-12344143 CCGCTTTTAAAGGTGAAGCAGGG - Exonic
1154301852 18:13201141-13201163 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1155341028 18:24814299-24814321 CTGGCTTTGAAGGTGGAGGACGG - Intergenic
1155437024 18:25824192-25824214 CTGGCTTTGAAGATGGAGGCAGG - Intergenic
1155745260 18:29348601-29348623 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1155843398 18:30674789-30674811 CAAATTTTGAAGATGGAGGAAGG - Intergenic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156255543 18:35392369-35392391 CTTCTTTGGAAGATGAAGGAAGG + Intergenic
1156307009 18:35886665-35886687 CTGCTATTGAAGGTGGAGGAAGG - Intergenic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1156389382 18:36636282-36636304 ATCCCTTTGGAGATGGAGCAGGG + Intronic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157270141 18:46268180-46268202 CTGCTTTTGAAGAAGAAACTAGG + Intergenic
1158203348 18:54963855-54963877 CTGGTTTTGAAGGTGTAGAAAGG - Intergenic
1158219320 18:55133893-55133915 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1159816099 18:73075351-73075373 CTGACTTTGAAAATGGAGGAAGG - Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160006621 18:75073278-75073300 CTCCTGTTGAAGATGGAGCCTGG + Intergenic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG + Intronic
1160674020 19:379086-379108 CTGGCTTTGAAAATGGAGCGAGG - Intergenic
1160913464 19:1485857-1485879 TTGTTTTTGAAGATGGAGTCTGG - Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162584989 19:11553102-11553124 TTGCTTTTGTAGAGGAAGCAAGG - Exonic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1164732044 19:30513762-30513784 CTTGTTTTGGAGGTGGAGCAAGG + Intronic
1166284066 19:41812776-41812798 CTCGCTTTGAAGATGGAGGAAGG - Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166820539 19:45576694-45576716 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1167159277 19:47756677-47756699 TTGCGTTTGAACCTGGAGCAGGG - Exonic
1167424985 19:49425607-49425629 CTGTTATTGAAGATGGAGCTAGG - Intronic
1168222987 19:54974483-54974505 CTGCTTCTGAAAAAGGAGAAGGG - Exonic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1202689504 1_KI270712v1_random:77020-77042 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
925435408 2:3833086-3833108 CTGCCTTTGAAGACAGAGGAAGG - Intronic
925481944 2:4285255-4285277 CTGGCTTTGAAGATGAAGGAGGG + Intergenic
926656092 2:15407964-15407986 CTGTCTTTGAAGATAGAGAAAGG - Intronic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
927676746 2:25111778-25111800 CTGGCTTTGAAGATAGAGAAGGG + Intronic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928236550 2:29546893-29546915 CCGCTGCTGAAGAAGGAGCATGG + Intronic
928309343 2:30196747-30196769 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
928686888 2:33759242-33759264 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
929342295 2:40835840-40835862 CTGCTTTAGAAGGTGGAGGGAGG + Intergenic
929571502 2:43025892-43025914 CTGACTTTGAAGATGGAGGCAGG - Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
930322837 2:49877684-49877706 CGGCTAATGAAGATGGAGAAAGG - Intergenic
930590912 2:53324737-53324759 CTGCCTTTGAAAATGGAGGAAGG + Intergenic
930769251 2:55115326-55115348 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
931040815 2:58297515-58297537 CTGATTTTGAAAATGGAGACTGG - Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932829475 2:74975113-74975135 CTGGCTTTGAAGATGGAGGGGGG + Intergenic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932872135 2:75412540-75412562 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
932886929 2:75556990-75557012 CTGCTTTTGAGGGTGGAGTAGGG - Intronic
933244347 2:79958499-79958521 CTGGGCTTGAAGATGGAGGAAGG + Intronic
933313079 2:80684720-80684742 CTAGTTTTGAAAATGGAGGAAGG - Intergenic
933449192 2:82424743-82424765 CTGGCTTTGAAGTTGGAGGAAGG + Intergenic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933619021 2:84515850-84515872 CTGCTTTGGTAGAAGGGGCACGG + Intergenic
933956930 2:87379072-87379094 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934061466 2:88298033-88298055 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
934241051 2:90270962-90270984 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934272127 2:91545723-91545745 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
934737679 2:96698243-96698265 CTCATTGTGAAGATGGAGCAGGG + Intergenic
934843984 2:97649969-97649991 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
934925350 2:98378295-98378317 CAGCTGTTGAAGCTGGAGTACGG - Intronic
934926675 2:98386768-98386790 CTGGCTTTGAAGATGTAGGAAGG + Intronic
935028876 2:99303331-99303353 GTGCTTTTGTAGGTGGAGCTGGG - Intronic
935072039 2:99703243-99703265 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935082389 2:99810870-99810892 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935141539 2:100357554-100357576 CTGGCTTTGAAAATGGAGGAGGG - Intergenic
935232168 2:101108596-101108618 CTGGTCTTGGAGATGGAGCAAGG - Intronic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935674442 2:105582062-105582084 CTGGCTTTGAAGATCGAGGAAGG + Intergenic
935679612 2:105624653-105624675 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
935848646 2:107195480-107195502 CTGCTTTTGAATAAGAAGCTTGG - Intergenic
935895729 2:107735513-107735535 CTGGTTTTGAAGGTCAAGCAAGG - Intergenic
936148108 2:109995349-109995371 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
936196585 2:110376099-110376121 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
936502299 2:113075644-113075666 CTAATTTTGAAGATGGAGTGAGG + Exonic
936663419 2:114567480-114567502 CTGATTTTGAAGATGAAGCAAGG + Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937426793 2:121806648-121806670 CTGGCATTGAAGATGGAGGAAGG + Intergenic
937519737 2:122697741-122697763 CTGGCTTTGAAGATGGAGATAGG - Intergenic
937600088 2:123721177-123721199 GTGGCTTTGAAGATGGAGGAAGG - Intergenic
937805492 2:126138631-126138653 CTGCTTTAGAAGATTGACCTTGG + Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938324454 2:130389061-130389083 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
938640885 2:133278392-133278414 TGGCTTTTGAAGATGGAGGAAGG - Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939046073 2:137251749-137251771 CTGATTTTGAAGTTGGAACTGGG + Intronic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
939096607 2:137839744-137839766 CTGGTTTTGAAGATAGAAGAAGG - Intergenic
939344593 2:140947473-140947495 CTGCTGTGGAAGAAAGAGCAGGG - Intronic
939462432 2:142514104-142514126 CTGCCTTTGAAGATGAAGGAAGG - Intergenic
939718446 2:145615774-145615796 CTCACTTTGAAGATGGAGAAAGG + Intergenic
940071301 2:149691041-149691063 CTGGCTTTGAAGATGAAGCAAGG - Intergenic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
940867332 2:158830381-158830403 CTGGCTTTGAAGATGGATTAAGG - Intronic
941063817 2:160878370-160878392 CTGAGCTTGAAGATGGAGGAAGG - Intergenic
941531360 2:166675240-166675262 CTGCTGTTCAAGATGGCCCAGGG - Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941564383 2:167088225-167088247 CTGCTTTAGGGGATGGTGCAGGG - Intronic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
941849842 2:170168596-170168618 CTGGCTTTGAAGGTGGAGAAGGG + Intergenic
942421319 2:175811034-175811056 CTGGTTTTGAAGAAAGAGAAAGG - Intergenic
942613843 2:177769340-177769362 CAGCTTTTGAACATGTTGCATGG + Exonic
942620689 2:177842544-177842566 CTGTTTAAGAATATGGAGCAGGG + Intronic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943426310 2:187739781-187739803 TTGACTTTGAAGATGGAGGAAGG - Intergenic
943519808 2:188934415-188934437 CCGGTGTTGAAGATGGAGCCTGG - Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
943976529 2:194485479-194485501 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
944157478 2:196622457-196622479 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
944798600 2:203212811-203212833 CTTCTTTTGGAGATGGAGGTAGG + Intronic
944862514 2:203828512-203828534 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945222363 2:207497827-207497849 ATGAATTTGAAGATGGAACAAGG - Intergenic
945755262 2:213837897-213837919 CTGGCTTTGAAGATGAAGGAAGG + Intronic
945918079 2:215725817-215725839 CTGGTTTTGAAGTTGGAGGAAGG - Intergenic
946932370 2:224683493-224683515 CTGACTTTGAAGATAGAGGAAGG + Intergenic
946965033 2:225028274-225028296 CTGGCTTTGAAGATGAAGGAAGG + Intronic
947110017 2:226708485-226708507 CTGGTTTTGAAGATGAGGAAAGG + Intergenic
947246659 2:228055998-228056020 CTGTCATTGAAGATGGAGCAAGG - Intronic
947259858 2:228208831-228208853 CTGCCTTTGAGGTTGGAGAAAGG + Intergenic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
947665441 2:231902607-231902629 CTGGTTTTGAAGACGGAAGAAGG - Intergenic
947950351 2:234141790-234141812 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
948115168 2:235490092-235490114 CTGACTTTGAAGATGCAGGAGGG - Intergenic
948121030 2:235530584-235530606 CTGGTTTTGAAGACAGAGGAAGG - Intronic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
948506256 2:238428756-238428778 TTGCTTTTGAATCTGGAGCTGGG + Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948715859 2:239862787-239862809 CTGGTTTCGAAGATGGGGGAAGG + Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169609503 20:7363151-7363173 TTGCTTCTGAAGAAGGAGAAAGG + Intergenic
1169713511 20:8590671-8590693 CTGCCTTTGAAGTTGGAGGAAGG - Intronic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170129583 20:13004562-13004584 CTGACTTTGAAGATGGGGGAAGG + Intergenic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170517619 20:17148384-17148406 CTGGCTTTGAATATGGAGAAAGG - Intergenic
1171177579 20:23064558-23064580 TTGGCTTTGAAGATGGAGCTAGG - Intergenic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1172769661 20:37373733-37373755 ATGATTTTTAAGATGGAGCTAGG - Intronic
1172812836 20:37662042-37662064 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
1172886630 20:38235552-38235574 CTGGCTTTGAGGATGGAGGAAGG + Intronic
1173132973 20:40411798-40411820 CTCCCATTGAGGATGGAGCAGGG - Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173390728 20:42630167-42630189 CTACCTTTGAAGATAGAGGAAGG + Intronic
1173488017 20:43455917-43455939 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173646594 20:44637104-44637126 CTGCTTTTGAAAATGGAGCCTGG - Intronic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1174302987 20:49595614-49595636 CTGGCTTTGAAGATGGAGGTTGG - Intergenic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1174543275 20:51306445-51306467 CTGCATTTGAAGCAGGAGCATGG + Intergenic
1175019929 20:55835075-55835097 CTGATTTTGAAGATTGAGGAGGG - Intergenic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175495971 20:59414503-59414525 CTGGCTTGGAAGATGGAGGATGG - Intergenic
1175541041 20:59747814-59747836 CTGCTGGAGATGATGGAGCAGGG + Exonic
1175641748 20:60636015-60636037 CTACCTGTGAAGATGGAGGAAGG - Intergenic
1175692134 20:61073178-61073200 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1175801163 20:61801710-61801732 CTGCCCTTGAAGACAGAGCAAGG - Intronic
1176427398 21:6557261-6557283 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1177289058 21:19086525-19086547 GAGGTTTTGAAGATGGAGAAAGG + Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1177573841 21:22924923-22924945 CTAGCTTTGAAGATGGAGTAAGG + Intergenic
1178258114 21:31073962-31073984 CTGGCTTTGAAGATGGAGGGAGG - Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178917598 21:36717120-36717142 ATGCTTTTGAAGAATGAGAAGGG - Intronic
1179008542 21:37535060-37535082 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1179034143 21:37745430-37745452 CTGGTTTTGAAGATGTGGGAAGG + Intronic
1179074183 21:38103084-38103106 CTGCATTTGAGGATGTAGCAGGG + Intronic
1179147252 21:38778929-38778951 CTGGCATTGAAGATGGAGGATGG + Intergenic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179169462 21:38961804-38961826 CTGCCTTTAAAGATGGACGAAGG - Intergenic
1179240090 21:39582197-39582219 CTGGCTTTGAAGATGCAGGAGGG + Intronic
1179381090 21:40899840-40899862 CTGGTTTTGGAGATGAAGCGGGG - Intergenic
1179402832 21:41099966-41099988 CTGCCTTTGAAAATGGAGGAAGG - Intergenic
1179533887 21:42038989-42039011 CTGGCCTTGAAGATGGAGGAGGG + Intergenic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1179702889 21:43165578-43165600 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1181352112 22:22266482-22266504 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1181781505 22:25196908-25196930 ATGCTTTGTAAGATGGGGCAGGG + Exonic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182049364 22:27301127-27301149 GTTATTTTGAAGATGAAGCAAGG + Intergenic
1182053508 22:27331408-27331430 CTGGTCATCAAGATGGAGCAGGG + Intergenic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1182665792 22:31958924-31958946 CTGCTTGGGAGGATGGAGCCCGG + Intergenic
1184187711 22:42875979-42876001 CTGCTTTTGACAATGAAGCCAGG + Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184640845 22:45869197-45869219 CTGCTTCTGAGAACGGAGCACGG - Intergenic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
1184923606 22:47622749-47622771 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
949092253 3:42124-42146 TTGGTTTTGATGATGGAGGAAGG - Intergenic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
949147630 3:721865-721887 CTGGTTTTGAAGATGGAAGAAGG + Intergenic
949187099 3:1205119-1205141 CTGATTTTAAAGATAGAGAAAGG + Intronic
949204141 3:1417686-1417708 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
951164905 3:19473551-19473573 TTACTCTTAAAGATGGAGCAAGG - Intronic
951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG + Intergenic
951313296 3:21157312-21157334 CTGACATTGAAGATGGAGGAAGG - Intergenic
951594444 3:24301896-24301918 TTGACTTTGAAGATGGAGGAAGG + Intronic
951786734 3:26428788-26428810 CTGGCTTTGAAGGTGGAACAAGG + Intergenic
951796082 3:26539986-26540008 CTGATTTTGGAGATGGACTACGG + Intergenic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952518406 3:34129289-34129311 CTACCTTTGAAGGTGGAGGAAGG - Intergenic
953210856 3:40873787-40873809 CTGGGTTTGCAGAGGGAGCAAGG - Intergenic
953294250 3:41696893-41696915 CTGGCTTTGAAGATGGAATAAGG + Intronic
953373695 3:42410994-42411016 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953857519 3:46511441-46511463 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
954464122 3:50644722-50644744 CTGCTTTTGAAAATAGATCCAGG + Intronic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954661262 3:52228127-52228149 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
954872509 3:53778412-53778434 CTGGTTTTGAAGAGGGTGCCGGG + Intronic
955169573 3:56550194-56550216 TTGGCTTTGAAGATGGAGAAGGG - Intergenic
955234112 3:57124507-57124529 CTGGTTTTGTGGATGGAGGAAGG + Intronic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
955463209 3:59208369-59208391 CTGCCTTTGAAGATGAAGGAAGG + Intergenic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957128996 3:76199252-76199274 CTGGCTTTGAAGATGTAGGAAGG + Intronic
957771363 3:84696428-84696450 CTGGTTTTGAAGATAGATAAAGG + Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
959013561 3:101107874-101107896 CTTCCTTTGAAGATGAAGGAAGG + Intergenic
959087688 3:101868748-101868770 CTGGCTTTGAGGATGGAGCAAGG + Intergenic
959167114 3:102794038-102794060 CTGATCTTGAAAATGGAGAAAGG + Intergenic
959266044 3:104140101-104140123 CTGGCTTTGAATATGGAGTAAGG + Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959448477 3:106468979-106469001 GAGCTTTTGAAAATAGAGCAAGG - Intergenic
959531973 3:107443309-107443331 TGGCTTTTGGAGAGGGAGCAGGG - Intergenic
959747231 3:109790931-109790953 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
959848708 3:111063420-111063442 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
960304024 3:116039525-116039547 CAGCTTTTCAAGATGGTGCATGG - Intronic
960380485 3:116954560-116954582 CTGGTCTTGAAGGTGCAGCAAGG - Intronic
960400115 3:117186690-117186712 CTGCTGTTGAAAGTGGGGCATGG + Intergenic
960594732 3:119397840-119397862 CTGCTATTCAGGATGGATCAGGG - Intronic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
961154416 3:124666605-124666627 CTCCTTTTGAACATGTAGCCAGG - Intronic
961170672 3:124795754-124795776 CTGGTTTTGAAAATGGAAGAAGG + Intronic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
961990172 3:131181269-131181291 CTAGCTTTGAAGATGGAGGAAGG + Intronic
962274901 3:134004712-134004734 CTAGTTTTGAGGATGGAGGAAGG + Intronic
962904088 3:139786344-139786366 CATCTTTTGAAGATGGAGGAAGG + Intergenic
963006797 3:140734035-140734057 CTGGCTTTGAAGTTGGAGGAAGG - Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
963617467 3:147559824-147559846 CTGGATTTGAAGGTGGAGGAAGG - Intergenic
963981706 3:151545432-151545454 CAGCTTTGGAGGATGAAGCAAGG + Intergenic
964219747 3:154329601-154329623 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
965186155 3:165467040-165467062 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
965221003 3:165925348-165925370 CTGATTTTGAAGATGGGGAAAGG + Intergenic
965246693 3:166280673-166280695 CTGGTTTTGAAGATGAAGGAAGG - Intergenic
965355667 3:167670120-167670142 CTGGTTTAGAATCTGGAGCAAGG + Intergenic
965361337 3:167742675-167742697 CTTCTGTGGTAGATGGAGCAGGG + Intronic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
965651664 3:170939711-170939733 CTGGCTTTGAAGATTGAGAAAGG - Intergenic
965777813 3:172251379-172251401 CTGCTTTTGTAGATAGAAGAAGG - Exonic
965856335 3:173092556-173092578 CTGGCTTTGAAGACGGAGGAAGG + Intronic
966018567 3:175176723-175176745 CTGGCTTTGAGGATGGAGTAAGG + Intronic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
966666127 3:182472929-182472951 CTGGTTTTGAGGATGGAGGAAGG - Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967545036 3:190715449-190715471 CTGTTTTGGACCATGGAGCACGG + Intergenic
967851354 3:194084944-194084966 CTGGCTTTGAAGATAGAGAAAGG - Intergenic
968004050 3:195227165-195227187 CTGCTTTTGAACATGAAGCTGGG + Intronic
968028949 3:195466423-195466445 CTGGCTTCGAAGATGGAGCAAGG - Intergenic
968121398 3:196128427-196128449 CTGGCTTTGAAGATGAAGAAGGG + Intergenic
968976078 4:3822692-3822714 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969065305 4:4474706-4474728 CTGGTTTTGAAGATGGGGAAAGG + Intronic
969119346 4:4896312-4896334 CTCGTTTTGAAGATGAAGGAAGG + Intergenic
969197332 4:5573417-5573439 CTGGCTTTGAAGATGAAGAAAGG + Intronic
969212865 4:5701127-5701149 CTGCCTTTGACAATGGAGGAAGG - Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969342722 4:6552435-6552457 ATGGTTTTGAAGATGGAGGGAGG - Intronic
970016352 4:11516803-11516825 CTGATTTTGAATATGGAGGAAGG - Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970527934 4:16951248-16951270 CTGGCTTTGAAGATGCAGGAAGG + Intergenic
970656803 4:18240227-18240249 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
970743224 4:19263007-19263029 CTACTTTTAAAAATGGAGAAAGG - Intergenic
970774099 4:19652236-19652258 CGGGCTTTGAAGATGGAGGAGGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970938946 4:21608473-21608495 ATGCCTTTGAAAATGGAGGAAGG - Intronic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971708004 4:30073142-30073164 TTTCTTTGGAAGATGGAGGAGGG + Intergenic
971795335 4:31219683-31219705 CCGGCTTTGAAGATGGAGAAAGG - Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972205887 4:36772253-36772275 GTGTTTTGGAAGATGGAGAAAGG - Intergenic
972464576 4:39342861-39342883 CTGGCTTTGAAGATGCAGGAAGG - Intronic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972791430 4:42374957-42374979 CTGGCTTTGAAGATGGCGGAAGG - Intergenic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
973968905 4:56191327-56191349 CTGGTTTTGAAGAGGGAGGAAGG - Intronic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
974379118 4:61115730-61115752 TTGCTTTTGAAGAGGCAACATGG - Intergenic
974895669 4:67935247-67935269 GTGGTGTTGAAGATGGAGCCAGG - Intronic
975062533 4:70020172-70020194 CTGGCTTTGAACATGGAGGAAGG - Intergenic
975280649 4:72558373-72558395 CTGGTTCTGAGGATGGAGGAAGG - Intronic
975524979 4:75339181-75339203 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
976537557 4:86236058-86236080 CTGGCTTTGAAGGTGGAGTAAGG - Intronic
976708213 4:88041215-88041237 CTGATTTGGAAGTTGGGGCAAGG - Intronic
976962571 4:90997252-90997274 CTGGCTTTGAAGATGAAGGATGG - Intronic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
978232785 4:106421067-106421089 CTGTCTTTGAAGACGGAGTAAGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978842314 4:113229332-113229354 CTGGCTTTGGAGATGGAGAACGG - Intronic
978985269 4:115004431-115004453 CTGCTTTTGCAGCTGGCTCATGG + Intronic
979056669 4:116003556-116003578 CTGCTTTTCAAGTTGGAGGTGGG - Intergenic
979202425 4:117994222-117994244 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
979257986 4:118624344-118624366 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
979330363 4:119416219-119416241 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
979466312 4:121042388-121042410 ATGCTTTTGGAGATGGAGAATGG + Intronic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
979666886 4:123321560-123321582 CTGGATTTGAGGATGGAGAAAGG + Intergenic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
980082776 4:128362072-128362094 CTGGTTTTGAAGCTGGAAGAGGG + Intergenic
980102032 4:128551484-128551506 CTGGCTTTGAAGATGAAGGAGGG - Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
980402089 4:132303851-132303873 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
980851743 4:138390594-138390616 CTGGTTTTGAAGCTGGAGGAAGG + Intergenic
981184469 4:141784526-141784548 CTGGCTTTGAAGATGGAGAGAGG + Intergenic
981291598 4:143082728-143082750 CTGACTTTGAAGATGGAAGAAGG + Intergenic
981612036 4:146603973-146603995 ATGCTGTTGAAGATGGTGGAGGG + Intergenic
981701365 4:147610533-147610555 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
981872121 4:149498739-149498761 CTTCTCTTGAAGGTGGACCATGG - Intergenic
982030714 4:151297996-151298018 TTGGCTTTGAAGATAGAGCAAGG + Intronic
982525980 4:156478775-156478797 CTGGCTTTGAAGATGGTGGATGG + Intergenic
982650345 4:158080609-158080631 GTGGTTTGGAAGATGGAGCAAGG - Intergenic
983572814 4:169228476-169228498 CTCCTGTTGAAGATGGAGGAAGG - Intronic
983743811 4:171169243-171169265 ATGCTAATGAAGATGAAGCAGGG + Intergenic
983760436 4:171399253-171399275 CTGCTTTTTAAAAAGGATCAAGG - Intergenic
984261379 4:177446556-177446578 ATGCTTATAAAGATGGTGCATGG + Intergenic
984352905 4:178618820-178618842 TTGGCTTTGAAGATGGAGAAAGG + Intergenic
984799402 4:183699767-183699789 CTGGTTTTGAAGACAGAGGAAGG - Intronic
985124075 4:186674189-186674211 CTGCTTCTGAATATGGAAAATGG - Intronic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
985987243 5:3526192-3526214 CTTCTCTTGAACATGGAGGAGGG + Intergenic
986232885 5:5883308-5883330 CTTCTTTTTCAGATGGAGCTTGG - Intergenic
986391452 5:7291057-7291079 CTGTTTTTGTAGATCGTGCAGGG + Intergenic
986645296 5:9910969-9910991 TGGGCTTTGAAGATGGAGCAAGG - Intergenic
986664646 5:10090193-10090215 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
986788494 5:11138167-11138189 CTGGCTTTGAGGATGGAGAAAGG - Intronic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987214117 5:15714932-15714954 CTGGCTTTGAAGATGGAACAGGG + Intronic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
987721337 5:21636674-21636696 CTGGTTTTGAAGAAGGCGGAAGG - Intergenic
988099545 5:26659478-26659500 CTGCTTTTGAAAATAGTGGAAGG + Intergenic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
990232225 5:53725777-53725799 CTGGTTTTGAAAATAGAGGAAGG - Intergenic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
990736569 5:58869932-58869954 TTGATTTTGAAGAAGGAGAATGG + Intergenic
991025182 5:62021521-62021543 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
991274930 5:64834808-64834830 TTGCTTTTGGAGATGGCTCAGGG - Intronic
991419629 5:66427964-66427986 TTGCCTTTGAAGATGGAAGAAGG + Intergenic
991439376 5:66630464-66630486 CTCCTTTTCAAGATAGAACAAGG - Intronic
991598748 5:68331520-68331542 TTGCCTTTGAAGATGGAGGAAGG + Intergenic
992324814 5:75650350-75650372 CTGGTTTTGACAATGGAGCAAGG + Intronic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
992828625 5:80572737-80572759 CAGATATTGAAGATGGAGGAAGG - Intergenic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993483274 5:88450905-88450927 CTGGCTTTGAAGATGAAACAAGG - Intergenic
993731555 5:91428837-91428859 CTGGCTTTGAAGATGGAAAAAGG + Intergenic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
994750937 5:103736137-103736159 TTGGTTTTGAAGATGAAGGAAGG - Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995437788 5:112157590-112157612 CTGGCTTTGAAGATGTAGGAAGG - Intronic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995664307 5:114523965-114523987 CTGACTTTTTAGATGGAGCATGG - Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
995956496 5:117783030-117783052 GTGCTTTTAAATATGGATCAAGG + Intergenic
996092096 5:119361436-119361458 ATGGTTTTGAAGATGGGGGAGGG + Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996624755 5:125557312-125557334 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996876521 5:128246415-128246437 CTTGCTTTGAAGATGGAGAAAGG - Intergenic
997144435 5:131417404-131417426 CTCCTTTTAAAGAGAGAGCAAGG - Intergenic
997202952 5:132023744-132023766 CAGCTCTAGAAGATAGAGCAGGG - Intergenic
997261547 5:132469231-132469253 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
997305356 5:132831797-132831819 ATGGTGTTGAAGAAGGAGCAGGG - Intergenic
998188710 5:140003478-140003500 CTGGTTTTGAAGGTGGAAAATGG + Intronic
998340015 5:141409122-141409144 TTGATTTTGAAGATGTAGAAAGG + Exonic
998955820 5:147437153-147437175 CTGCTTCTTAAGAGGGAGCTGGG - Intronic
999005582 5:147973776-147973798 CTGCCTTTGAAGCTGGAGAAAGG - Intergenic
999383851 5:151140483-151140505 ATGCTTTGGAAGGTGGTGCAGGG - Intronic
1000075845 5:157784992-157785014 CTCATTTTGAAGATAAAGCACGG - Intergenic
1000755064 5:165147915-165147937 CTGGCTTTGGAGATGGAGAAAGG + Intergenic
1000895159 5:166846470-166846492 CTGGCTTTGAAGATGAAGAAAGG - Intergenic
1000895266 5:166847596-166847618 CTATTTTTGAAGATAGAGGAGGG + Intergenic
1000933913 5:167285131-167285153 CTGCTTTTGGAGATCCAGCATGG + Intronic
1000971645 5:167721550-167721572 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1001070428 5:168580270-168580292 CTCATTTTGAAGATGGGGCACGG + Intergenic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001234882 5:170021261-170021283 CTGCCTTTTAAGTGGGAGCAAGG + Intronic
1001244186 5:170093528-170093550 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1001834630 5:174821425-174821447 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1002172340 5:177382431-177382453 CTGCTTTGGAGCATGGATCAGGG + Intronic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1002463885 5:179394165-179394187 CTGATTTTGAAAATGGAGGAAGG - Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1002962696 6:1931225-1931247 GTTCTTTTGCAGATGAAGCAGGG + Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1004375222 6:15085300-15085322 CTGATTTTGAAGAATGAGGAAGG - Intergenic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006611876 6:35298909-35298931 CTCCTTTGGAGGATGGGGCAGGG - Intronic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1007517812 6:42427495-42427517 GTGCTTTGGAAGATGGAGGCAGG - Intronic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008669098 6:53748347-53748369 CTGCCTTTGAAGACAGAGGAAGG + Intergenic
1008957913 6:57235859-57235881 CTGGCTTTCAAGATGGAGAAGGG + Intergenic
1009304876 6:62076015-62076037 ATGCGTTTGAATATGGGGCAGGG + Intronic
1009351499 6:62684860-62684882 TTGGTTTTGAAGATGGAAGAAGG + Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009700574 6:67173020-67173042 GTGATTTTGAAGATGGATTATGG + Intergenic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009934952 6:70223214-70223236 TTGCTTTTTAAGGTGGATCAAGG - Intronic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011277542 6:85644099-85644121 CTGCTTTTGAAGGGGGAACGGGG + Intergenic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1011989604 6:93497533-93497555 CTGCTTTGGAAGAGAGATCAAGG - Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1012586433 6:100928594-100928616 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1012833828 6:104240178-104240200 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1012927375 6:105281279-105281301 CTGGTTTTGACAATGGAGGAAGG - Intronic
1013420295 6:109960981-109961003 CTGGTCTTGAAGATGGAGAGAGG + Intergenic
1013526249 6:110976533-110976555 CTGGCTTTGAATATGGAGGAAGG - Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013861439 6:114640435-114640457 GTAGTTTTGAAGATGGAGGAGGG + Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1014291461 6:119563312-119563334 CTGTCTTTAAAGATGGTGCATGG - Intergenic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1014801477 6:125783015-125783037 CTGCCTTTGAAAAGGGAGGAAGG + Intronic
1014820561 6:125984425-125984447 CTGCCCTAGAAGATGGAACATGG + Intergenic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015275289 6:131377747-131377769 CTGGCTTTGAAGAAGGAGAAAGG - Intergenic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016349768 6:143154713-143154735 CTGGTTTTGAGGATGTACCATGG + Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1016689412 6:146919272-146919294 CTGCTTTAAAAGATGAAGCCAGG + Intergenic
1017632779 6:156413700-156413722 CTCATTTTGAAGATGGAAGACGG + Intergenic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1018637700 6:165878816-165878838 TAGCCTTTGAAGATGGAGGAAGG + Intronic
1018657315 6:166050710-166050732 CTAGTCTTGAAGATGGAGAAAGG + Intergenic
1019739827 7:2667112-2667134 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1020037934 7:4976358-4976380 CTGCATTTGAAAATGGAAGAGGG + Intergenic
1020146798 7:5650647-5650669 CTGGCTTTGAAGATGGATGAAGG - Intronic
1020159767 7:5761059-5761081 CTGCATTTGAAAATGGAAGAGGG - Exonic
1020218840 7:6218329-6218351 CTGGGTTTGAAGATGGAGAGAGG + Intronic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021365022 7:19767568-19767590 CTGATTTTGATGAGGGAGTAGGG + Intronic
1021619330 7:22536103-22536125 CAGCTTTTAAAGAAGGAGCATGG - Intronic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1022287553 7:28968662-28968684 CTAGTTTTGAAAATGGAGGAGGG + Intergenic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023399975 7:39785634-39785656 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1023803250 7:43852949-43852971 CTGGCATTGAAGATGGAGTAAGG - Intergenic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024072906 7:45801403-45801425 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1024287654 7:47773158-47773180 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1024650430 7:51398775-51398797 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025054569 7:55754439-55754461 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025132626 7:56384586-56384608 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025909834 7:65819508-65819530 CTGACTTTGAAGATGGAGTCAGG + Intergenic
1025911345 7:65831386-65831408 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1025978279 7:66386812-66386834 CTGACTTTGAAAATGGAGTAAGG - Intronic
1026146044 7:67747609-67747631 CTGGCTTTGAAGACGGGGCAGGG + Intergenic
1026540186 7:71273269-71273291 CAGCGTTTGAAATTGGAGCAAGG - Intronic
1026654934 7:72248451-72248473 CTGACTTTGAAGATGGTGGAAGG - Intronic
1026904806 7:74056837-74056859 TGGCTTTGGAAGATGGGGCAGGG - Intronic
1027203863 7:76081497-76081519 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1027943631 7:84717678-84717700 CTGGCTTTGAAGATGGGGAAGGG + Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028163300 7:87509964-87509986 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1028371930 7:90101487-90101509 CAGCTTTTAAAGAAGGAGCATGG + Intergenic
1028843658 7:95455383-95455405 CTGGCTTTGAAGATGGACGAAGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1030284450 7:107811428-107811450 CTGGTGTTGAAGATGCAGGAAGG - Intergenic
1030348733 7:108459782-108459804 CTGGGTTTGAAGATGGAGTGAGG - Intergenic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030426966 7:109390294-109390316 CTGGCTTTGAAGATAGAGTAAGG - Intergenic
1030465415 7:109895746-109895768 CTAGCTTTGAAGATGGAGAAAGG - Intergenic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1030608933 7:111668134-111668156 CAGATTTTGAAGATGGAGAAAGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1031132072 7:117844116-117844138 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1031622011 7:123945694-123945716 CTGGTATTGAAGATGGTGAAAGG + Intronic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032558567 7:132863738-132863760 CTGATGTGGAAGCTGGAGCAAGG - Intronic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1033619296 7:143048131-143048153 CTGGCTTTGAAGATGGACGAGGG + Intergenic
1033858922 7:145600369-145600391 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1034201937 7:149288102-149288124 CTGCTTTGGAAGATGGAATGGGG + Intronic
1034381630 7:150700955-150700977 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035473499 7:159126756-159126778 CTGCTCTTGATGATTCAGCATGG + Intronic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036282276 8:7410742-7410764 CTGGATTTGAAGATGAAGGAAGG - Intergenic
1036339192 8:7900828-7900850 CTGGATTTGAAGATGAAGGAAGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036625296 8:10466114-10466136 TTGACTTTGAAGATGGAGGAAGG + Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037226902 8:16603223-16603245 CTGGGTTTGATGATGGAGAAAGG + Intergenic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038410368 8:27353840-27353862 CTGCTATTGAAGATGAAGCAGGG + Intronic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038616528 8:29100802-29100824 CTGCTCTTGAAGATGGATTGTGG + Intronic
1038641947 8:29335938-29335960 TTGCTTTTGAAGCTGGTTCATGG - Exonic
1039077429 8:33704423-33704445 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1039232705 8:35465896-35465918 CTCATTTTGAAGGTGGAGGAAGG + Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039741202 8:40384522-40384544 CTGATTTTGAAGATGGTGAATGG + Intergenic
1039970403 8:42317032-42317054 CTGGTTTTTAAGTTGGAGTATGG + Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040079140 8:43270190-43270212 CTGCTCTTAAAGGTGAAGCAGGG - Intergenic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041396003 8:57391867-57391889 CTGACTTTGAAAATGGAGGAAGG + Intergenic
1041492404 8:58449029-58449051 CTGGTTTTTAAGATGGAAGAAGG - Exonic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1042817691 8:72895381-72895403 CTGCCTTTGAAGGTGGAAGAAGG + Intronic
1043582056 8:81725525-81725547 CTGGTTTTGAAGACTGAGAAAGG - Intronic
1043927971 8:86059515-86059537 GTGCTTTTGAAGATGGAGAGAGG - Intronic
1044000105 8:86868989-86869011 CTGGCTTTGAAGATGGAGGGGGG + Intronic
1044159092 8:88890222-88890244 CTGCTGTTCAAGATGTGGCATGG - Intergenic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG + Intergenic
1044802863 8:95975061-95975083 CTGCCTTTGGAGATGGAGGAGGG + Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1045237393 8:100365288-100365310 CTGGTTTTGAAGCTGGGGAAAGG + Intronic
1045284638 8:100779876-100779898 CTGCTTTTTTTGATGCAGCATGG + Intergenic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1045769643 8:105720902-105720924 CTACTTTTACAGATGCAGCAAGG - Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046489799 8:114936658-114936680 CTGCCCTTGAAGATGGAGCAAGG + Intergenic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1047356323 8:124125548-124125570 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
1047407180 8:124595483-124595505 CTGGCTTTGAAGATGGACAAAGG - Intronic
1047665520 8:127087015-127087037 CTTCTTTGGAAGGTGGAGAATGG + Intergenic
1047748910 8:127865553-127865575 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1048286070 8:133142688-133142710 CTGCTTTGAAAGATGATGCAGGG + Intergenic
1048450243 8:134527137-134527159 CTGGCTTTGAAGGTGGAGAAGGG + Intronic
1048489628 8:134880609-134880631 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1048894143 8:138974168-138974190 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1049302813 8:141880532-141880554 CTGCTTGTGAGGATGAAGCAGGG - Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1049976321 9:863443-863465 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050331116 9:4547297-4547319 CTACTTTTGAAGCTATAGCATGG + Intronic
1050768322 9:9164270-9164292 CTGACTTTGAAGATAGAGGAAGG - Intronic
1050962250 9:11749559-11749581 CCGACTTTGAAGATGGAGGAAGG - Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1051851328 9:21512331-21512353 CCGCTTTTGAAGATGTAGTTAGG + Intergenic
1051925823 9:22323559-22323581 CTGCCTTTGAAGGTGGAGGAAGG - Intergenic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1052016930 9:23479612-23479634 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054999769 9:71435938-71435960 CTGCCTTTGAAAATGGAGAAAGG + Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055440491 9:76331762-76331784 CTGCCTTTGAAGACAGAGGAAGG + Intronic
1055452327 9:76442143-76442165 CTGGTTTTGAAGCCGGAGGAAGG + Exonic
1055567964 9:77587981-77588003 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1055894024 9:81155087-81155109 CTGGTTTTGAAGATAGATGAAGG - Intergenic
1056118143 9:83461247-83461269 CTGGCTTTGAAGATGGAGGCAGG + Intronic
1056485530 9:87053322-87053344 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1056741357 9:89258064-89258086 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1057497566 9:95572907-95572929 ATGGTTTTGAAGATGGTCCAGGG + Intergenic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057858770 9:98623636-98623658 CTGGCTTTGAAAATGGAGGAAGG - Intronic
1057926389 9:99154649-99154671 CTGGTTTTGATGATGGAGGAGGG - Intergenic
1058035930 9:100252895-100252917 GTGCTTTTCCAGGTGGAGCAAGG + Exonic
1058108415 9:101002488-101002510 CTGGTTTTGAAGATGGAAGTGGG + Intergenic
1058116564 9:101091477-101091499 CTGGGTTTGAAGATGAAGGAAGG - Intronic
1058286389 9:103185010-103185032 ATGGTTTTGAAGATGGAGAAAGG + Intergenic
1058388398 9:104465320-104465342 TGGCTTTTGAAGACGGAGGAAGG + Intergenic
1058650101 9:107167618-107167640 TTGCTTTTCAAGATGTAGCTTGG + Intergenic
1058666209 9:107318316-107318338 TTGCCTTTGAAGATGCAGAAAGG - Intronic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1058978851 9:110150439-110150461 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1059152613 9:111963153-111963175 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1059894187 9:118842007-118842029 CTGGCTCTGAAGATGGAACAAGG - Intergenic
1059949866 9:119451090-119451112 CTGGTTTTAAAGGTGGAGGAAGG - Intergenic
1060033407 9:120234783-120234805 CTGATTTTGTAGATGGGGAATGG - Intergenic
1060036504 9:120260479-120260501 CTGGTACTGAAGGTGGAGCATGG - Intergenic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1061020031 9:128008377-128008399 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061819825 9:133220910-133220932 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1061916051 9:133754828-133754850 CTGGCTTTGAAGATGGAGCATGG + Intergenic
1062240830 9:135537038-135537060 CTGGCTTTGAAGGTGGAGGAGGG - Intergenic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1185856005 X:3535906-3535928 CTGGTTTTGAAGACAGAGGAAGG - Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186059955 X:5694194-5694216 CTGCTTTAGGGGATGGGGCAGGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186501597 X:10055258-10055280 CTGCCTTTGAGAATGGAGGAAGG + Intronic
1186557416 X:10574279-10574301 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186656569 X:11618095-11618117 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186755749 X:12669743-12669765 CTGGTTTTGAAGATGAAGGAAGG + Intronic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187333896 X:18365121-18365143 CTGGCTTTGAAGATGGACAAAGG - Intergenic
1187504077 X:19864540-19864562 GTGGCTTTGAAGATGGAGGAAGG + Intronic
1188299224 X:28487058-28487080 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1188410913 X:29871107-29871129 CCGGTTTTGAAGATGGAAAAAGG - Intronic
1188434466 X:30145150-30145172 CTGACTTTGAAGACGGAGGAAGG + Intergenic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1188570516 X:31579979-31580001 CTGGCTTTGAAGATAGAGAAAGG - Intronic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1188683312 X:33039233-33039255 CTACTTTTGAAGTTGAAACATGG - Intronic
1188746429 X:33850445-33850467 CTGTCTTTGAAGATGAAGAAAGG + Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189722298 X:43932863-43932885 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1189909958 X:45800707-45800729 CTGTTTTAAAAGATGGGGCAGGG + Intergenic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190528591 X:51352553-51352575 CTGGCTTTGAAGATGGAGTTAGG - Intergenic
1190576380 X:51843462-51843484 ATGGCTTTGAAGATGGAGGAAGG + Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1190955532 X:55189362-55189384 CTGCTTTTGAATGTCAAGCAGGG - Intronic
1191801942 X:65091243-65091265 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1191901491 X:66045337-66045359 CTAACTTTGAAGATGGAGGAAGG + Intergenic
1191922439 X:66271001-66271023 CTGCTTTTTAAAGTGGATCACGG + Intergenic
1192321659 X:70095020-70095042 CTGCTTTTGCAGAAACAGCAAGG + Intergenic
1192341357 X:70266242-70266264 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1193061991 X:77216473-77216495 CTGGTTTTGAAAATGAACCATGG + Intergenic
1193085015 X:77441210-77441232 CTGCATTTGAAGCTGTAGCGAGG - Intergenic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1193983745 X:88215267-88215289 CTGGTTTTGAAGATGTAGGAAGG - Intergenic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194230372 X:91315330-91315352 TTCCTTGTGAAGATTGAGCATGG - Intergenic
1194754924 X:97727629-97727651 CTGCCTTTGAAAATAGAGAAAGG + Intergenic
1194861383 X:99002832-99002854 CTGGTTTTGAAAATGGAGGGAGG + Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195026513 X:100882990-100883012 CTGACTTTGAAGATAGAGAAAGG + Intergenic
1195376752 X:104235073-104235095 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1195494196 X:105510721-105510743 CTGACTTTGAAGATGGTGGAAGG + Intronic
1195521793 X:105839013-105839035 CTGGATTTGAAGTTGGTGCAGGG + Intronic
1196326586 X:114412593-114412615 ATGCTTTGGAACATGGAGCAGGG - Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1197253568 X:124239416-124239438 CTGGCTTTGAAGATGAAGAAAGG - Intronic
1197333487 X:125182179-125182201 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197498013 X:127209610-127209632 CTGTCTTTGAAGATGAAGGAAGG - Intergenic
1197610896 X:128637063-128637085 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197646338 X:129021711-129021733 CTGGCTTTGAAGGTGGAGAAAGG - Intergenic
1197948268 X:131863947-131863969 CTGCCTTTGAAGATGAATTATGG - Intergenic
1198007738 X:132515845-132515867 CTGATTTTGAAGATGAATAAGGG - Intergenic
1198377341 X:136052871-136052893 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1198431219 X:136568049-136568071 CTGGCTTTGAAGATGGAGGCCGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199538611 X:148932172-148932194 CTGCTTGTGAGGATGAATCATGG + Intronic
1199611239 X:149616478-149616500 CTGGTTTTGATGATAGAGAAAGG - Intronic
1199611635 X:149621750-149621772 TTGACTTTGAAGATGGAGGAAGG - Intronic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199735321 X:150680672-150680694 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1199759045 X:150891403-150891425 CTGGCTTTGAAGATGGAGCAAGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199821033 X:151446604-151446626 CTGGCTTTGATGATGGAGTAAGG + Intergenic
1199923208 X:152431790-152431812 CTGACTTTGAAGATGGGGGAAGG + Intronic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1200320816 X:155187200-155187222 CTGACTTTGAAGATAGAGCAAGG + Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201675950 Y:16584276-16584298 CAGCCTTTGGAAATGGAGCAGGG - Intergenic