ID: 966438943

View in Genome Browser
Species Human (GRCh38)
Location 3:179922127-179922149
Sequence GCTTGTAAGATGATGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966438941_966438943 9 Left 966438941 3:179922095-179922117 CCGACTTGTAACTGCTGGGATTA 0: 1
1: 0
2: 1
3: 19
4: 210
Right 966438943 3:179922127-179922149 GCTTGTAAGATGATGGATCATGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966438943 Original CRISPR GCTTGTAAGATGATGGATCA TGG Intronic
901172425 1:7269252-7269274 CCTTGACAGATGTTGGATCAAGG + Intronic
905924230 1:41738600-41738622 TCCTGTGAGCTGATGGATCATGG - Intronic
907709360 1:56864330-56864352 GATTGTAAAGTGATGAATCATGG + Intronic
911192024 1:94957780-94957802 GCCTGGAGGATAATGGATCATGG + Intergenic
915675166 1:157523087-157523109 CTTTGTGAGATGCTGGATCATGG + Intronic
916835017 1:168534983-168535005 GCTTGCAGGATGATGTATAAGGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921575524 1:216830600-216830622 GGTTGTAAGATGCAGGATCTTGG + Intronic
923434489 1:233955445-233955467 GGTTGTAGGAGGATGAATCAAGG - Intronic
1063584107 10:7335334-7335356 GATTGTAAGAAGTTGGGTCATGG - Intronic
1067763007 10:49063896-49063918 GCTGCAAAGAGGATGGATCAGGG - Intronic
1076321743 10:129588100-129588122 GATTGTAAGAGGAGAGATCATGG + Intronic
1079753715 11:24229634-24229656 GCTTAGATGATGATGCATCAGGG - Intergenic
1080472685 11:32561357-32561379 GGTTGTAAAATGGTGGTTCAAGG + Intergenic
1083001918 11:59300284-59300306 GTTGGTAAGATGAGGGCTCAGGG - Intergenic
1086164183 11:83758378-83758400 GCTGGTAAGCTAAAGGATCAAGG - Intronic
1090135021 11:124188545-124188567 GATTGTGAGCTGCTGGATCAAGG - Intergenic
1096083056 12:48845731-48845753 CCTTGGAAGGTGATGCATCACGG + Exonic
1096601136 12:52730454-52730476 CCTTGGAAGGTGATGCATCATGG - Intergenic
1099810242 12:87571838-87571860 ACTTGGAAGAGGATGCATCAGGG - Intergenic
1103052972 12:117796918-117796940 GCTTGTTAAATGAGTGATCAGGG - Intronic
1103667837 12:122584403-122584425 GCTTGCTAGATCATGTATCATGG - Exonic
1111406628 13:87814955-87814977 GCTTGTAAGTAGATGGCACATGG + Intergenic
1113716736 13:112514504-112514526 GCTTTTAAAATGATTGATGAGGG - Intronic
1126156222 15:45567998-45568020 GGTTGTGAGATGATGGGTCTAGG + Intergenic
1129895796 15:79104966-79104988 GCTTCTTAGAACATGGATCAAGG + Intergenic
1133573198 16:7062423-7062445 GCTTGTATGTGGATGAATCATGG + Intronic
1135388765 16:22070411-22070433 GGTGGTAACATAATGGATCAAGG + Intronic
1135813969 16:25615186-25615208 GGATGTCAGATGGTGGATCACGG + Intergenic
1136071369 16:27789502-27789524 GATGGAAAGATGATGGATGATGG + Exonic
1141384040 16:83603093-83603115 GCTTTTATGATTATGGATCATGG + Intronic
1145186359 17:20798071-20798093 GCGTGAAAGATCATGGGTCATGG - Intergenic
1148410754 17:47464776-47464798 GCATGAAAGATCATGGGTCATGG + Intergenic
1149125507 17:53225553-53225575 GCTGGTAAGAGGAAGGGTCATGG + Intergenic
1151272624 17:73008623-73008645 GCTAGTAAGATGAGTGACCAAGG - Intronic
1151948127 17:77330424-77330446 GCTGGTGAGATTATGGCTCAGGG - Intronic
1153876807 18:9380387-9380409 CCATGTAACATAATGGATCACGG - Intronic
1158659930 18:59377626-59377648 GCTTGTAAGGTAAGGGATCATGG + Intergenic
1159302334 18:66590849-66590871 CCTTGTAAGATGAAGGAGCATGG + Intronic
1162621821 19:11849550-11849572 GCAGGGAAAATGATGGATCAAGG + Intronic
1168305004 19:55430418-55430440 GCTCCTAAGATGATGGCTCTTGG + Exonic
931610104 2:64089956-64089978 GTTTGAAAGAAGAGGGATCAAGG - Intergenic
939303831 2:140383582-140383604 ACATGTAAGAGGATGGATCCAGG - Intronic
942721299 2:178956164-178956186 GCTTGTAAGAGTACGGATCCTGG - Intronic
1169774216 20:9234731-9234753 ACTTGTAAGATGTTGGATTGGGG + Intronic
1178516924 21:33255848-33255870 GCTTGTGAGGTGATGGGGCAGGG - Intronic
952159333 3:30678154-30678176 GCTTGTGGGATCATGGATCAGGG + Intronic
955835891 3:63054726-63054748 GCTTGTAAGATGCCTGTTCATGG + Intergenic
959977881 3:112482389-112482411 GCTTGTCAGATGTTGAACCAAGG + Intronic
961843707 3:129741092-129741114 GCTTGAAAGATAATAGATCCTGG - Intronic
964851679 3:161102759-161102781 GCTTTTAACAGGATGGATCATGG - Intronic
966438943 3:179922127-179922149 GCTTGTAAGATGATGGATCATGG + Intronic
969480526 4:7444681-7444703 GCTTCTAAAAGGATGGATCTGGG + Intronic
973915807 4:55634139-55634161 TCTTGCATGATGATTGATCATGG + Intronic
974654194 4:64798511-64798533 GCTTGTGAGAAGATGGAATATGG + Intergenic
975785207 4:77880299-77880321 GCTTTGAAGATGAAGGATGAGGG - Intronic
978311569 4:107390026-107390048 CTTTGTAAGATGTTGGATGATGG - Intergenic
978933366 4:114345151-114345173 GCTTCTTAGATGATGGCCCATGG - Intergenic
979549556 4:121975627-121975649 TCTTGGCTGATGATGGATCATGG + Intergenic
982311010 4:153984986-153985008 GCTTCTAAGATTATGGATTGAGG + Intergenic
984321169 4:178198389-178198411 GGTTGTAACATTATGGATAAAGG - Intergenic
986150575 5:5126265-5126287 GCTCTTAAGATGATGGAGGAAGG + Intergenic
987083288 5:14445739-14445761 CCTTGAAAGCTGATGGATTATGG + Intronic
987765443 5:22222730-22222752 GGTTGTAGGATGATGGATTGTGG + Intronic
988387921 5:30590668-30590690 GCTTTGAAGATGGTGGAACAAGG + Intergenic
991961161 5:72045686-72045708 GTTTGTAGGATGATGGATATAGG + Intergenic
993955034 5:94221902-94221924 GCTTGTTAGATACTGCATCAAGG + Intronic
994199694 5:96958746-96958768 GCTTTGAAGATGAAGGAGCAGGG - Intronic
997867976 5:137481689-137481711 TCTTGTTGGATGATGGGTCACGG + Intronic
999865095 5:155692827-155692849 GCTTGGAAGATGCAGGATCCTGG - Intergenic
1000257324 5:159552318-159552340 GCTTATCAGATGATGGAGGAAGG + Intergenic
1001904475 5:175460394-175460416 ACTTGAAAGATCATGGAACAAGG - Intergenic
1006726634 6:36203819-36203841 GCTAATAAGATGGTGGATCCAGG - Intronic
1007406233 6:41637730-41637752 GCTTCTAAGATGAGGGTTCGGGG - Intronic
1009717285 6:67414614-67414636 GCTTGGAATATGATGTATCTTGG + Intergenic
1010800043 6:80164486-80164508 GTTTGTTAGATGATGAACCAGGG - Intronic
1011833824 6:91405120-91405142 TCTGGTAATATGATGAATCAAGG + Intergenic
1012218441 6:96617995-96618017 AGTTGTAGGAGGATGGATCATGG + Intergenic
1016046819 6:139489485-139489507 CCTTATAAAATGATGGATCAAGG - Intergenic
1024571445 7:50725968-50725990 GCTTGTAATGGGATAGATCAGGG - Intronic
1033569960 7:142618016-142618038 GCTTTTGAGATGAGGGAACAGGG - Intergenic
1036500175 8:9307050-9307072 GCTTCTAAGATGAATGATCAAGG + Intergenic
1037124147 8:15324643-15324665 GCTTGCAAGATGATGTATTGTGG - Intergenic
1042893415 8:73638299-73638321 GTTTGTAAAATGCTGGATCAAGG - Intronic
1045691465 8:104764050-104764072 TCTTCTATGCTGATGGATCATGG - Intronic
1051441888 9:17093533-17093555 TGTTGTGAGATGATGGATGAGGG + Intergenic
1052634035 9:31077683-31077705 GGTAGTCAGATGCTGGATCATGG + Intergenic
1052649494 9:31282945-31282967 GGTTCTAAGATGATGGATAGGGG + Intergenic
1187033923 X:15517716-15517738 CCTGGAAAGAGGATGGATCAAGG - Intronic
1188910069 X:35836430-35836452 GCTTGCAAGAAGCTGGATGAGGG - Intergenic
1190518596 X:51251975-51251997 GTTTTTAATATGATGGATAATGG + Intergenic
1192539191 X:71954076-71954098 GCCTGTAACATAATGGAGCAAGG - Intergenic
1194159359 X:90431989-90432011 GCTTGCATGATGATGGAAGATGG - Intergenic
1197664949 X:129213588-129213610 GCTAGTAAGAAGATGGAAGACGG + Intergenic
1199066089 X:143420106-143420128 GTTTGGAAGATGATGGGTAATGG - Intergenic
1199665715 X:150094957-150094979 GCTTGGAAGAGGAAGGAACAAGG - Intergenic