ID: 966443381

View in Genome Browser
Species Human (GRCh38)
Location 3:179973311-179973333
Sequence CTGTTCCTGGGCAAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966443381 Original CRISPR CTGTTCCTGGGCAAGATCTG TGG (reversed) Intronic
900242721 1:1624648-1624670 CCATTCCCGGGCAAGAGCTGGGG + Intronic
900955333 1:5883219-5883241 CTGTGCCAGGGCCAGAGCTGCGG + Intronic
900992820 1:6105815-6105837 CTGGTCCTGGGCAGGAAGTGAGG + Intronic
901460610 1:9389025-9389047 CTGTCCCTGGGGAAGATTTATGG + Intergenic
902569698 1:17339268-17339290 CTGGTCCTGAGCAAGAAGTGGGG - Intronic
902749851 1:18500049-18500071 CTGTTCTTGGGCAAGAGGGGAGG + Intergenic
903005062 1:20293005-20293027 CTGTGTCTGGCCCAGATCTGGGG - Intronic
903093208 1:20942019-20942041 ATGTTTCTGTGCAAGATGTGAGG + Exonic
903263817 1:22144717-22144739 CAGCTCCAGGGCAAGGTCTGAGG - Intergenic
903273152 1:22204641-22204663 CTGTTGCTGGCCGAGATGTGGGG + Intergenic
903331973 1:22601140-22601162 CTGTCCCAGGGACAGATCTGGGG - Intronic
903448164 1:23435780-23435802 CTGGTCCTGGAGAAGAACTGGGG + Intronic
904438533 1:30514983-30515005 CTGGGCCTGGGCCACATCTGGGG + Intergenic
905376173 1:37522269-37522291 CTGTGCCTGGCCAAGAGCGGAGG - Intergenic
906178922 1:43801214-43801236 GTGTTCATGGGCAATATTTGTGG + Intronic
906188510 1:43880310-43880332 CTTTTCCTTGGGAAGATTTGGGG - Intronic
906509753 1:46404305-46404327 CTGCTCCTGGGGAGTATCTGGGG - Intronic
906760675 1:48374516-48374538 ATTTTCCTGGGCAAGAATTGAGG - Intronic
907283065 1:53363290-53363312 CTTTGCATGGGCAAGTTCTGTGG + Intergenic
909610642 1:77548386-77548408 CAGAACCTGGGCATGATCTGGGG - Intronic
912739228 1:112178086-112178108 CAGTTGCAGGGCAACATCTGTGG + Intergenic
915908635 1:159898630-159898652 TTGCACCTGGGCAAGACCTGTGG - Intronic
920516344 1:206587180-206587202 CTGATCCTTGGCAGAATCTGTGG - Exonic
920570713 1:207015174-207015196 CAGTTCCTGGACAAGAGCTGTGG + Intronic
921647183 1:217632324-217632346 CTCTTCCTGGGCAAGAAGTTTGG - Intronic
923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG + Intronic
924768152 1:247053298-247053320 ACTTTCCTGGGCAAAATCTGGGG - Intronic
1064549663 10:16486476-16486498 CTGAGCCTGGGCATGAGCTGTGG - Exonic
1067538947 10:47137814-47137836 CTGTCCCTGCGCAATTTCTGTGG + Intergenic
1068117558 10:52751411-52751433 CTATTCCTGGGCATGTGCTGGGG - Intergenic
1070441880 10:76454670-76454692 CTTTCCCTGGGCCAGATGTGTGG + Intronic
1070716260 10:78724249-78724271 CTGCTTCTGGGCAGGATCTCAGG + Intergenic
1070823221 10:79375421-79375443 CTTATCCTGGGCAAGAACTCTGG - Intergenic
1073645192 10:105294173-105294195 CAGTTCCTGGGCAACAAGTGTGG - Intergenic
1074047978 10:109856689-109856711 CTGGTCCTGAGCAATAGCTGGGG + Intergenic
1074149713 10:110747364-110747386 TTGAGCCTGGGCAGGATCTGTGG - Intronic
1074203038 10:111256847-111256869 CTGTTCCTGGGAGAGCACTGAGG - Intergenic
1074854737 10:117465165-117465187 GTGTTCCCAGGCAAGATGTGTGG + Intergenic
1076776303 10:132699888-132699910 CTGAAGTTGGGCAAGATCTGGGG + Intronic
1077353394 11:2103442-2103464 CTGTTCCAGGGACAGCTCTGTGG - Intergenic
1079899007 11:26157605-26157627 CTGATCCTGGGCAACATTAGGGG + Intergenic
1081395385 11:42580434-42580456 CTGTGCATGAGCAAGATTTGGGG - Intergenic
1081678479 11:44985219-44985241 CCGTTCCTTGGGAAGAACTGAGG + Intergenic
1085693975 11:78688359-78688381 CAGGTCCTGTGCAAGATATGTGG - Intronic
1088669975 11:112131421-112131443 CTGTTCCAGGGGAAGATCTGGGG - Intronic
1090068907 11:123526761-123526783 CTGTTCCTGGGCTTAATCTTGGG + Intronic
1097967024 12:65592185-65592207 CTGTTCCTGGGCAATTTTTTTGG + Intergenic
1098703149 12:73653940-73653962 CTGTTTCTGGCCATGATTTGAGG + Intergenic
1099524890 12:83706569-83706591 ATGGTCTTGGGAAAGATCTGGGG - Intergenic
1100099096 12:91080665-91080687 CTGTTCCTTAACAAGATCTTGGG - Intergenic
1100302973 12:93324927-93324949 CTGTGCCTGGCCAAGATTAGGGG + Intergenic
1101188156 12:102303724-102303746 CTGTTCCAGGACCAGAGCTGTGG - Intergenic
1101641222 12:106586846-106586868 CTGTGCCTGGGCAAGAATGGAGG - Intronic
1102014230 12:109637325-109637347 TTGTGCCTGGGCCAGCTCTGGGG - Intergenic
1102919821 12:116783466-116783488 CTATTCCTGGTCAACATATGTGG - Intronic
1103617940 12:122166899-122166921 CTGAGCCTGCGCTAGATCTGCGG + Intergenic
1107389706 13:39951427-39951449 CTGATCCTGTGTAACATCTGTGG - Intergenic
1108250787 13:48565741-48565763 TTGTCCCTGGGCTAAATCTGTGG - Intergenic
1109334074 13:60970917-60970939 GGTTTCCTGGGCCAGATCTGAGG + Intergenic
1110103789 13:71644564-71644586 CTTTTCTTGCGGAAGATCTGAGG - Intronic
1111161003 13:84394543-84394565 ATTTTCCTGGGCAGAATCTGGGG - Intergenic
1111303331 13:86373425-86373447 GTGGTCTTGGGTAAGATCTGAGG + Intergenic
1111533788 13:89575231-89575253 CTTTTCCTGGGAAACATATGAGG + Intergenic
1113150962 13:107263133-107263155 CTGTTCCTGACCAAGATCATTGG + Intronic
1116045641 14:39739940-39739962 CAATTCCTGGGCAAGTCCTGGGG + Intergenic
1116669091 14:47817915-47817937 ATTTTCCTGGGCAGAATCTGGGG - Intergenic
1119731717 14:76955511-76955533 GTGTTCCTGTGCAGGATCTATGG - Intergenic
1121027060 14:90624332-90624354 CTGCCCCTGGGGAAGCTCTGGGG + Intronic
1121235574 14:92389422-92389444 CTGTTCATGGGGAAGAACGGTGG - Intronic
1121728625 14:96171089-96171111 GGGGTCCTGGGCCAGATCTGGGG - Intergenic
1123995303 15:25713963-25713985 CTGCTCCTGAGCAAGCTCCGAGG + Exonic
1125579509 15:40775530-40775552 GTGAGCCTGGGCAGGATCTGTGG - Intronic
1129605390 15:77022602-77022624 CTGATCTTGGGGAGGATCTGGGG - Intronic
1131020770 15:89096145-89096167 CTGTGCCTGGGCAGGTTCTATGG - Intronic
1131230414 15:90654876-90654898 CTGTCCCTGGCCCAGCTCTGAGG + Intergenic
1131435659 15:92419508-92419530 CTGTGCCTGGCCATGGTCTGGGG + Intronic
1132751806 16:1461088-1461110 CAGTTTCTGGCCAACATCTGAGG + Intronic
1135739147 16:24958416-24958438 CTCTTGCTGGGCAAGTTCAGAGG - Intronic
1136127056 16:28191657-28191679 CTGTCACTGGGCAAGAGCTCTGG - Intronic
1137910802 16:52376136-52376158 CCGTTTGTGGGCAAGAACTGGGG - Intergenic
1142869712 17:2812180-2812202 CTGTTCTTGGGGATGACCTGGGG - Intronic
1147137926 17:38444740-38444762 CAGCTCCTGGGCAACCTCTGTGG + Intronic
1148349277 17:46928173-46928195 GTGCTCCTAGGCAAGACCTGTGG - Intronic
1149643107 17:58217899-58217921 CTGTTCCTGGGCAAGAGTGTGGG - Intronic
1153349560 18:4063773-4063795 CTGTTTCTGGCCAGGCTCTGAGG + Intronic
1156220279 18:35044139-35044161 CAGTTCCCTGGCAAGATCAGAGG + Intronic
1158002582 18:52636459-52636481 CTCTGCCTGGGAAAGGTCTGGGG + Intronic
1158322883 18:56282629-56282651 CTGTTCCTGGATAAGGTATGAGG + Intergenic
1159014599 18:63090817-63090839 CTGTGCCTGGGGAGGAACTGGGG + Intergenic
1159802655 18:72920152-72920174 CAATTCCTGGGCAAGTCCTGAGG - Intergenic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1160855193 19:1214127-1214149 CTGTTCCTCGCCAAGCTCTTAGG + Intronic
1160856724 19:1221130-1221152 CTGTCCCTGGGGTAGAGCTGGGG + Intronic
1160868097 19:1264972-1264994 CTGTTGCTAAGCAACATCTGAGG + Intronic
1160920238 19:1516170-1516192 CTGTTCCTGGGCACCAGCAGGGG + Intergenic
1162741888 19:12778222-12778244 CTGCTCCGGGGCAAGGTCTCTGG - Intronic
1165360254 19:35332065-35332087 CTGCTCCTGGGTAAGGACTGTGG + Exonic
1165701706 19:37943163-37943185 CTCTGCCTGGCCAAGAGCTGAGG + Intronic
1165746763 19:38234095-38234117 CAGGTCCTGGGCAGGGTCTGAGG - Intergenic
1168629163 19:57943809-57943831 CTGTTCCTGGGCAGGTGCTGCGG - Intronic
930411960 2:51035478-51035500 TTGTTTCTGGGCAAGATGTGAGG + Intergenic
930574339 2:53127582-53127604 ATTTTCCTGGGCAGAATCTGGGG - Intergenic
932347576 2:71005717-71005739 CTGAGCCTGTGCAAGACCTGGGG - Intergenic
932568634 2:72924946-72924968 CTGTTCCTGGGCAAAACTGGCGG + Intronic
932655004 2:73602724-73602746 CAGTGCCTGGGCAAGATGTAAGG - Intronic
932663146 2:73674349-73674371 CAGTGCCTGGGCAAGATGTAAGG - Intergenic
932758352 2:74423960-74423982 CTGTCCCTGGGCAGGCTCGGTGG - Exonic
934090143 2:88543969-88543991 CTGTTGCTGGGCCAGGACTGAGG + Intergenic
934579245 2:95425445-95425467 CTTTTCCTGGGCAAAGCCTGGGG + Intergenic
934600201 2:95651279-95651301 CTTTTCCTGGGCAAAGCCTGGGG - Intergenic
936049613 2:109213185-109213207 CTCTTCCTTGGCAAGAACTCTGG + Intronic
936125879 2:109788825-109788847 CTGTTCCTGGCCCTCATCTGGGG + Intergenic
936218814 2:110582643-110582665 CTGTTCCTGGCCCTCATCTGGGG - Intergenic
936533548 2:113293275-113293297 CTTTTCCTGGGCAAAGCCTGGGG - Intergenic
943314837 2:186374526-186374548 ATGTTCCTAGGCTAGAACTGGGG + Intergenic
944905046 2:204253730-204253752 CTCATCCTGGACAAGATTTGGGG - Intergenic
944961700 2:204882264-204882286 TTGTTGCTGGGCAATATTTGAGG + Intronic
945198040 2:207255776-207255798 CTGTTCATCATCAAGATCTGAGG - Intergenic
946080349 2:217113227-217113249 CTGTTCCTGGGAAAGGTGGGTGG + Intergenic
946766470 2:223045268-223045290 CCCTTCCTGGGGAAGATGTGGGG - Intergenic
948880174 2:240852721-240852743 CCCATCCTGGGCAAGTTCTGAGG - Intergenic
1169039300 20:2479946-2479968 CTTTCCCTGGGCCACATCTGAGG + Intronic
1169252586 20:4071909-4071931 CTGATCCAGGGGAAGCTCTGGGG + Intronic
1170348789 20:15417300-15417322 GTGGTCCTGGGCCAGATATGGGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174843077 20:53918015-53918037 CTGTTTCTGGGCTAAATCAGGGG - Intergenic
1175584287 20:60125739-60125761 CTGTTTCAGGATAAGATCTGCGG - Intergenic
1176275297 20:64262695-64262717 CTGTTCCTGTGCTTGCTCTGTGG + Intronic
1179716828 21:43292762-43292784 CTTTTCCTTGGCAAGAGGTGTGG - Intergenic
1180107471 21:45629627-45629649 CTGTTCCTGGGTGAGACTTGCGG - Intergenic
1181000378 22:19985321-19985343 CTGTTTCTGGGCCAGTCCTGGGG - Intronic
1181816566 22:25441707-25441729 ATGTACCTTGTCAAGATCTGTGG + Intergenic
1182593353 22:31399264-31399286 CTGTTCCTCGCCAGCATCTGCGG - Intergenic
1183640514 22:39089850-39089872 CTGTTCCTGGGTAAGACCAAGGG + Intergenic
1184787991 22:46681014-46681036 GTGTTCCTGGGAAGGATGTGAGG - Intergenic
949644791 3:6080657-6080679 CTGTTCCTGAACCAGGTCTGTGG + Intergenic
952149189 3:30567830-30567852 ATGGTCTTGGACAAGATCTGGGG - Intergenic
952953561 3:38542985-38543007 CTGTCCCTGGGAAAGTCCTGAGG + Intergenic
953774351 3:45802826-45802848 CAGTTCGTGGGCAAGGTCTGTGG - Intergenic
953879496 3:46684238-46684260 GAGTTCCTGGCCAAGCTCTGGGG - Intronic
955137829 3:56237470-56237492 CTTTTCCTGGGCAGGTTTTGGGG + Intronic
955341506 3:58128941-58128963 CTCTGCCTGGGAAAGTTCTGGGG - Intronic
956719833 3:72108054-72108076 CTGTTTCTTGGCATGATCCGAGG - Intergenic
957753008 3:84447354-84447376 GTGTTTATGGGCAAGAGCTGAGG - Intergenic
958617801 3:96517808-96517830 CTGTTCTTGAGAATGATCTGTGG - Intergenic
959665295 3:108914222-108914244 TTGTGCCTGGGCAATAGCTGAGG - Intronic
960008824 3:112811225-112811247 CTGTTCTTGGGCAAGGGCTCTGG - Intronic
960152811 3:114267912-114267934 CTGTGCCTGGCCATGATCTTTGG + Intergenic
961168591 3:124780197-124780219 TTGTTCCTGGGCCAGAGTTGAGG - Intronic
961383493 3:126510717-126510739 CAGCTCCTGGGCAAACTCTGGGG + Exonic
962473566 3:135736045-135736067 CTGTTTCTGGTCAAGAGCTCAGG - Intergenic
965140367 3:164825425-164825447 CTGTTCCTGGAAAAAAACTGAGG - Intergenic
966443381 3:179973311-179973333 CTGTTCCTGGGCAAGATCTGTGG - Intronic
966917120 3:184591113-184591135 CTGTTCCTGGGGATGGGCTGGGG - Intronic
969473998 4:7410848-7410870 ATGTTCTGGGACAAGATCTGAGG + Intronic
969966797 4:11004954-11004976 CTCCACCTGGGGAAGATCTGAGG - Intergenic
973724067 4:53754647-53754669 CCGTCCCTGGGCAAGGTATGAGG - Intronic
975886453 4:78971840-78971862 CTGTGCCTGGTGAAGACCTGTGG + Intergenic
984598081 4:181694377-181694399 CTACTCCTGGGCTAGATCTAAGG + Intergenic
986465317 5:8015183-8015205 CTGTTCCTGGGCACTCTCTTGGG + Intergenic
988198200 5:28034889-28034911 TTGTACCTGGACAAGATCTGGGG + Intergenic
988538539 5:32089420-32089442 CTGTTCCTGAGCAAGGCATGTGG + Exonic
989267258 5:39489912-39489934 CTCTCCTTGGGCAAGATCTCTGG - Intergenic
989782663 5:45288036-45288058 ATATTCTTGGGGAAGATCTGTGG + Intronic
993482938 5:88447673-88447695 CTGGTCCAGGGTAAGGTCTGTGG - Intergenic
995044835 5:107633886-107633908 CACTTCCTGGGCTAGATCTAGGG - Intronic
995420178 5:111956081-111956103 CTGTTCCTTGGCAACTTCTTAGG - Intronic
995990569 5:118233851-118233873 CTATTCCTGGCCAAGTTTTGTGG - Intergenic
997195803 5:131978694-131978716 CTGCTCCTGGGCAAAAACTCAGG - Intronic
997730853 5:136173830-136173852 ATGTTCCTTTGCAAGATGTGAGG - Intronic
997759904 5:136434978-136435000 CTGTTGCTGGAAAAGACCTGAGG - Intergenic
999282936 5:150376658-150376680 CTGTTCCTGAGCCAGGGCTGAGG + Intronic
1002180972 5:177431033-177431055 CTGCTCCGGGGCAAGGTCTCAGG - Intronic
1002518266 5:179775015-179775037 CTGGCCCTGGGCAGGGTCTGTGG + Exonic
1003050221 6:2773905-2773927 CTGTCCCTGGGTAAGGGCTGTGG + Intronic
1003519019 6:6841880-6841902 CTGCTCCTGGCCAGGGTCTGGGG - Intergenic
1004049678 6:12063984-12064006 ATGTTCCTTGCCAAAATCTGAGG - Intronic
1004925184 6:20409577-20409599 ATGTTACTGGGCAAGGGCTGGGG - Intronic
1006579428 6:35068339-35068361 CTGTGCCTGGGGAAGCTCTGGGG + Intronic
1007200201 6:40101387-40101409 CAGTTCCTGGGTAAGATGAGAGG - Intergenic
1007701543 6:43769133-43769155 CAGTTCCCTGGCAACATCTGGGG + Intergenic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1011870429 6:91886106-91886128 GGTTTCCTGGGCCAGATCTGGGG + Intergenic
1014627229 6:123741875-123741897 ATGTTCCTGCTCAAGTTCTGAGG - Intergenic
1016063543 6:139655354-139655376 CTGAGCCTGGGAAAGCTCTGTGG - Intergenic
1016314482 6:142771251-142771273 CTGTCCATGTGCATGATCTGTGG + Exonic
1016862762 6:148737291-148737313 ATCTTCCTGGGGAAGTTCTGGGG - Intergenic
1018907277 6:168082905-168082927 CAGTGCCTGGGGAAGAACTGGGG - Intergenic
1019444872 7:1066149-1066171 CTGTTCCTGGACAAGCTCCATGG + Intronic
1019445980 7:1071616-1071638 CTGTTCCTGCCCAGGGTCTGTGG - Intronic
1019711927 7:2521756-2521778 GTGATCCTGAGCAAGACCTGGGG + Intronic
1019887632 7:3919271-3919293 CTCTGCCAAGGCAAGATCTGGGG + Intronic
1020006777 7:4787628-4787650 CTGTTCCAGGCCAGGAACTGTGG - Exonic
1020077069 7:5265222-5265244 CTGCTCTTGGGCAAGATGTGGGG - Intergenic
1020339905 7:7099058-7099080 CTGTTCATGGGAAATACCTGGGG + Intergenic
1023009586 7:35913875-35913897 CTGTTCCTGGGCAGGTGCAGTGG - Intergenic
1023793673 7:43773085-43773107 CAGTTGCTGGACAAGATGTGAGG - Intronic
1023999644 7:45182115-45182137 CTGTTGATGGGCCAGATCAGTGG + Intronic
1024081241 7:45857605-45857627 CTGTTCCTGGGCAGGTGCAGTGG + Intergenic
1024828108 7:53416285-53416307 CTGTTCCTAAGGAAGAGCTGAGG - Intergenic
1025123265 7:56324147-56324169 CTGTTCCTGGGCAGGTGCGGTGG - Intergenic
1025202039 7:56968425-56968447 CTGCTCTTGGGCAAGATGTGGGG + Intergenic
1025669908 7:63608503-63608525 CTGCTCTTGGGCAAGATGTGGGG - Intergenic
1025966776 7:66280308-66280330 CAATTCCTGGGCCAGATCTTGGG + Intronic
1026284863 7:68954403-68954425 CTCTTCCTGGGGAAGATTTGAGG - Intergenic
1026737202 7:72956534-72956556 TTTTTCCTGAGCAAGTTCTGTGG - Intergenic
1026787402 7:73310516-73310538 TTTTTCCTGAGCAAGTTCTGTGG - Intergenic
1027106530 7:75408534-75408556 TTTTTCCTGAGCAAGTTCTGTGG + Intronic
1027555665 7:79662008-79662030 CTGTTCCTTTGCAAAATATGTGG - Intergenic
1030969415 7:116036244-116036266 CTCTGCCTGGGAAACATCTGAGG - Intronic
1033218642 7:139512925-139512947 CTGCCCCTTGGCAAGATCTCTGG + Intergenic
1033366961 7:140679015-140679037 GAGTTTCTGGGCAAGTTCTGCGG + Intronic
1033601425 7:142891683-142891705 CGCTTCCTTAGCAAGATCTGGGG + Intergenic
1034253817 7:149713955-149713977 CTCTGCCTGGGCAATATCGGAGG - Intergenic
1035346390 7:158202458-158202480 CTGGGCCTGGGGAAGAGCTGGGG + Intronic
1035553155 8:545049-545071 CTGGTCCTGGGGAAGGTTTGGGG - Intronic
1036760232 8:11503645-11503667 CTCTTTCTTGGCAAGGTCTGAGG + Intronic
1037529002 8:19756587-19756609 CTGTTCGAGGGCATGATCTTGGG - Intronic
1038531078 8:28318231-28318253 CTGAACATGGGCAAGTTCTGGGG + Intronic
1038593068 8:28858474-28858496 CAGTTTTTGGGCAATATCTGTGG + Intronic
1039854090 8:41397810-41397832 CTGTTCCTGGGGAAGCACAGAGG - Intergenic
1040109752 8:43562046-43562068 CAGGTCCTGGGCCAGATCCGGGG - Intergenic
1040455983 8:47598281-47598303 GTCATCTTGGGCAAGATCTGTGG + Intronic
1040529437 8:48254316-48254338 ATTTTCCTGGGCAGAATCTGAGG - Intergenic
1040580581 8:48695709-48695731 CAGTTCCTGGTCAAAATATGGGG - Intergenic
1041854774 8:62438848-62438870 CTGTTCCTGGCCAGGCTCAGTGG - Intronic
1042316238 8:67429136-67429158 CAGTACCTGTGTAAGATCTGTGG - Intronic
1042629448 8:70800774-70800796 CTGTGCCTGGCCAGGTTCTGGGG + Intergenic
1042716267 8:71776248-71776270 CTGTTCATGGGAAAGTGCTGTGG + Intergenic
1043308060 8:78822067-78822089 CTGTTTCTGGGCCATTTCTGTGG + Intergenic
1044753674 8:95439941-95439963 ACTTTCCTGTGCAAGATCTGAGG + Intergenic
1045946499 8:107802351-107802373 CTGGCCCTGGGCAAGTCCTGCGG + Intergenic
1052585834 9:30426081-30426103 ATGGTCTTGGGCCAGATCTGGGG - Intergenic
1055339127 9:75263046-75263068 ATGGTCTTGGACAAGATCTGGGG + Intergenic
1056104307 9:83331880-83331902 TTGATCCTGGGTAAGATCTTGGG + Intronic
1056291585 9:85148962-85148984 CTGTTCCATAGCAAGATTTGGGG + Intergenic
1056309224 9:85322444-85322466 CTATTCCTGGGCCAGGTCTTGGG - Intergenic
1056731522 9:89170080-89170102 CTTTTCCTTGGGAAGATCCGAGG + Intronic
1057348967 9:94278570-94278592 CTGTTGCTGGCCCAGCTCTGTGG + Intronic
1059548075 9:115199194-115199216 TTGTTCCAGGGCAAGCTCCGAGG + Intronic
1062278671 9:135742433-135742455 CTGTGCCTGGGCCAGATGGGGGG - Intronic
1062551273 9:137087670-137087692 CGGTGCCTGGGCTACATCTGTGG + Intronic
1185523159 X:756889-756911 CTGGTCCTGGGCAGGCTCTGGGG - Intergenic
1192746606 X:73944759-73944781 CTGTTCCTAGGAAAGCTCTGAGG - Intergenic
1195095022 X:101493710-101493732 AGGATCCTGGGCTAGATCTGAGG + Exonic
1195598170 X:106716697-106716719 ATGTGCCAGAGCAAGATCTGTGG + Intronic
1197581489 X:128289026-128289048 ATGATCTTGGACAAGATCTGGGG - Intergenic
1199432853 X:147780230-147780252 CTGTGCCTTGGCAAGATGAGAGG + Intergenic
1199543823 X:148986350-148986372 CTGTTCCTGGGCAAGCCTTCAGG + Intronic
1199753845 X:150846317-150846339 CTGTTCCAGGGCAACACATGAGG + Intronic
1200417801 Y:2931070-2931092 CTGATCTTGGACAAGATTTGGGG - Intronic