ID: 966454107

View in Genome Browser
Species Human (GRCh38)
Location 3:180095059-180095081
Sequence AGGGAGAACACGGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966454107_966454119 30 Left 966454107 3:180095059-180095081 CCCACAATCACCGTGTTCTCCCT No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454107_966454117 28 Left 966454107 3:180095059-180095081 CCCACAATCACCGTGTTCTCCCT No data
Right 966454117 3:180095110-180095132 CATGCTTCCACGGCCACTGCCGG No data
966454107_966454118 29 Left 966454107 3:180095059-180095081 CCCACAATCACCGTGTTCTCCCT No data
Right 966454118 3:180095111-180095133 ATGCTTCCACGGCCACTGCCGGG No data
966454107_966454115 18 Left 966454107 3:180095059-180095081 CCCACAATCACCGTGTTCTCCCT No data
Right 966454115 3:180095100-180095122 CTCTCTGTGCCATGCTTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966454107 Original CRISPR AGGGAGAACACGGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr