ID: 966454119

View in Genome Browser
Species Human (GRCh38)
Location 3:180095112-180095134
Sequence TGCTTCCACGGCCACTGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966454114_966454119 5 Left 966454114 3:180095084-180095106 CCTGTGTACAGATTCTCTCTCTG No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454107_966454119 30 Left 966454107 3:180095059-180095081 CCCACAATCACCGTGTTCTCCCT No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454108_966454119 29 Left 966454108 3:180095060-180095082 CCACAATCACCGTGTTCTCCCTC No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454111_966454119 10 Left 966454111 3:180095079-180095101 CCTCCCCTGTGTACAGATTCTCT No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454113_966454119 6 Left 966454113 3:180095083-180095105 CCCTGTGTACAGATTCTCTCTCT No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454112_966454119 7 Left 966454112 3:180095082-180095104 CCCCTGTGTACAGATTCTCTCTC No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454109_966454119 20 Left 966454109 3:180095069-180095091 CCGTGTTCTCCCTCCCCTGTGTA No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data
966454110_966454119 11 Left 966454110 3:180095078-180095100 CCCTCCCCTGTGTACAGATTCTC No data
Right 966454119 3:180095112-180095134 TGCTTCCACGGCCACTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966454119 Original CRISPR TGCTTCCACGGCCACTGCCG GGG Intergenic
No off target data available for this crispr