ID: 966457428

View in Genome Browser
Species Human (GRCh38)
Location 3:180133675-180133697
Sequence CAGTGAGAAAGGAGAGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966457428_966457433 4 Left 966457428 3:180133675-180133697 CCTTCCGCTCTCCTTTCTCACTG No data
Right 966457433 3:180133702-180133724 ATGTACCACATTTGATAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966457428 Original CRISPR CAGTGAGAAAGGAGAGCGGA AGG (reversed) Intergenic
No off target data available for this crispr