ID: 966457433

View in Genome Browser
Species Human (GRCh38)
Location 3:180133702-180133724
Sequence ATGTACCACATTTGATAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966457427_966457433 15 Left 966457427 3:180133664-180133686 CCTAACTTGCTCCTTCCGCTCTC No data
Right 966457433 3:180133702-180133724 ATGTACCACATTTGATAGCAAGG No data
966457426_966457433 27 Left 966457426 3:180133652-180133674 CCTAAATATCTGCCTAACTTGCT No data
Right 966457433 3:180133702-180133724 ATGTACCACATTTGATAGCAAGG No data
966457431_966457433 -7 Left 966457431 3:180133686-180133708 CCTTTCTCACTGGTCCATGTACC No data
Right 966457433 3:180133702-180133724 ATGTACCACATTTGATAGCAAGG No data
966457428_966457433 4 Left 966457428 3:180133675-180133697 CCTTCCGCTCTCCTTTCTCACTG No data
Right 966457433 3:180133702-180133724 ATGTACCACATTTGATAGCAAGG No data
966457430_966457433 0 Left 966457430 3:180133679-180133701 CCGCTCTCCTTTCTCACTGGTCC No data
Right 966457433 3:180133702-180133724 ATGTACCACATTTGATAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966457433 Original CRISPR ATGTACCACATTTGATAGCA AGG Intergenic
No off target data available for this crispr