ID: 966461118

View in Genome Browser
Species Human (GRCh38)
Location 3:180177475-180177497
Sequence ACTGTAAGGTTCATGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966461118_966461123 12 Left 966461118 3:180177475-180177497 CCTGGCTTCATGAACCTTACAGT No data
Right 966461123 3:180177510-180177532 CTCAGTTGCAAAATTCGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966461118 Original CRISPR ACTGTAAGGTTCATGAAGCC AGG (reversed) Intergenic