ID: 966465312

View in Genome Browser
Species Human (GRCh38)
Location 3:180225231-180225253
Sequence TTTCCTGTAATGTGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966465308_966465312 22 Left 966465308 3:180225186-180225208 CCCAAAGGCTGACAATGAAAAGG No data
Right 966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG No data
966465307_966465312 27 Left 966465307 3:180225181-180225203 CCAATCCCAAAGGCTGACAATGA No data
Right 966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG No data
966465306_966465312 30 Left 966465306 3:180225178-180225200 CCACCAATCCCAAAGGCTGACAA No data
Right 966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG No data
966465310_966465312 21 Left 966465310 3:180225187-180225209 CCAAAGGCTGACAATGAAAAGGT No data
Right 966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966465312 Original CRISPR TTTCCTGTAATGTGTCCTGC AGG Intergenic
No off target data available for this crispr