ID: 966465879

View in Genome Browser
Species Human (GRCh38)
Location 3:180230946-180230968
Sequence CAGGTTAGAAAACCTGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966465879_966465884 30 Left 966465879 3:180230946-180230968 CCCTGTACAGGTTTTCTAACCTG No data
Right 966465884 3:180230999-180231021 GCCCAGGAACCCCATGCTCTTGG No data
966465879_966465883 14 Left 966465879 3:180230946-180230968 CCCTGTACAGGTTTTCTAACCTG No data
Right 966465883 3:180230983-180231005 TGTCAGTTTCTAACAGGCCCAGG No data
966465879_966465882 8 Left 966465879 3:180230946-180230968 CCCTGTACAGGTTTTCTAACCTG No data
Right 966465882 3:180230977-180230999 AAAGAATGTCAGTTTCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966465879 Original CRISPR CAGGTTAGAAAACCTGTACA GGG (reversed) Intergenic
No off target data available for this crispr