ID: 966470521

View in Genome Browser
Species Human (GRCh38)
Location 3:180283771-180283793
Sequence TTTACTCTGCTAGTTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966470521_966470525 3 Left 966470521 3:180283771-180283793 CCTGCTGCAACTAGCAGAGTAAA No data
Right 966470525 3:180283797-180283819 GAGGGCATCCTTTCAGAGGCAGG No data
966470521_966470524 -1 Left 966470521 3:180283771-180283793 CCTGCTGCAACTAGCAGAGTAAA No data
Right 966470524 3:180283793-180283815 AAGAGAGGGCATCCTTTCAGAGG No data
966470521_966470527 15 Left 966470521 3:180283771-180283793 CCTGCTGCAACTAGCAGAGTAAA No data
Right 966470527 3:180283809-180283831 TCAGAGGCAGGATTTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966470521 Original CRISPR TTTACTCTGCTAGTTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr