ID: 966470524

View in Genome Browser
Species Human (GRCh38)
Location 3:180283793-180283815
Sequence AAGAGAGGGCATCCTTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966470519_966470524 7 Left 966470519 3:180283763-180283785 CCCACATACCTGCTGCAACTAGC No data
Right 966470524 3:180283793-180283815 AAGAGAGGGCATCCTTTCAGAGG No data
966470520_966470524 6 Left 966470520 3:180283764-180283786 CCACATACCTGCTGCAACTAGCA No data
Right 966470524 3:180283793-180283815 AAGAGAGGGCATCCTTTCAGAGG No data
966470521_966470524 -1 Left 966470521 3:180283771-180283793 CCTGCTGCAACTAGCAGAGTAAA No data
Right 966470524 3:180283793-180283815 AAGAGAGGGCATCCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966470524 Original CRISPR AAGAGAGGGCATCCTTTCAG AGG Intergenic
No off target data available for this crispr