ID: 966470527

View in Genome Browser
Species Human (GRCh38)
Location 3:180283809-180283831
Sequence TCAGAGGCAGGATTTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966470519_966470527 23 Left 966470519 3:180283763-180283785 CCCACATACCTGCTGCAACTAGC No data
Right 966470527 3:180283809-180283831 TCAGAGGCAGGATTTCCTGATGG No data
966470520_966470527 22 Left 966470520 3:180283764-180283786 CCACATACCTGCTGCAACTAGCA No data
Right 966470527 3:180283809-180283831 TCAGAGGCAGGATTTCCTGATGG No data
966470521_966470527 15 Left 966470521 3:180283771-180283793 CCTGCTGCAACTAGCAGAGTAAA No data
Right 966470527 3:180283809-180283831 TCAGAGGCAGGATTTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966470527 Original CRISPR TCAGAGGCAGGATTTCCTGA TGG Intergenic
No off target data available for this crispr