ID: 966473708

View in Genome Browser
Species Human (GRCh38)
Location 3:180320877-180320899
Sequence TTGTAACATCACAGTAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966473708_966473711 15 Left 966473708 3:180320877-180320899 CCTTTATTACTGTGATGTTACAA No data
Right 966473711 3:180320915-180320937 CAGCTGGATTTTCAGATGACAGG No data
966473708_966473712 18 Left 966473708 3:180320877-180320899 CCTTTATTACTGTGATGTTACAA No data
Right 966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG No data
966473708_966473709 -1 Left 966473708 3:180320877-180320899 CCTTTATTACTGTGATGTTACAA No data
Right 966473709 3:180320899-180320921 ATAATCCAAAAGAACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966473708 Original CRISPR TTGTAACATCACAGTAATAA AGG (reversed) Intergenic
No off target data available for this crispr