ID: 966473710

View in Genome Browser
Species Human (GRCh38)
Location 3:180320904-180320926
Sequence AAAATCCAGCTGTGTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966473710_966473713 7 Left 966473710 3:180320904-180320926 CCAAAAGAACACAGCTGGATTTT No data
Right 966473713 3:180320934-180320956 CAGGTGGAGCATACAATTTCTGG No data
966473710_966473712 -9 Left 966473710 3:180320904-180320926 CCAAAAGAACACAGCTGGATTTT No data
Right 966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966473710 Original CRISPR AAAATCCAGCTGTGTTCTTT TGG (reversed) Intergenic
No off target data available for this crispr