ID: 966473712

View in Genome Browser
Species Human (GRCh38)
Location 3:180320918-180320940
Sequence CTGGATTTTCAGATGACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966473710_966473712 -9 Left 966473710 3:180320904-180320926 CCAAAAGAACACAGCTGGATTTT No data
Right 966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG No data
966473708_966473712 18 Left 966473708 3:180320877-180320899 CCTTTATTACTGTGATGTTACAA No data
Right 966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966473712 Original CRISPR CTGGATTTTCAGATGACAGG TGG Intergenic
No off target data available for this crispr