ID: 966474792

View in Genome Browser
Species Human (GRCh38)
Location 3:180331703-180331725
Sequence CTAGCTCTCCTGTTCTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966474790_966474792 3 Left 966474790 3:180331677-180331699 CCTTCTCTATATTCCAGTTCTGC No data
Right 966474792 3:180331703-180331725 CTAGCTCTCCTGTTCTCTGTTGG No data
966474791_966474792 -10 Left 966474791 3:180331690-180331712 CCAGTTCTGCTAACTAGCTCTCC No data
Right 966474792 3:180331703-180331725 CTAGCTCTCCTGTTCTCTGTTGG No data
966474789_966474792 4 Left 966474789 3:180331676-180331698 CCCTTCTCTATATTCCAGTTCTG No data
Right 966474792 3:180331703-180331725 CTAGCTCTCCTGTTCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966474792 Original CRISPR CTAGCTCTCCTGTTCTCTGT TGG Intergenic
No off target data available for this crispr