ID: 966480564

View in Genome Browser
Species Human (GRCh38)
Location 3:180403936-180403958
Sequence AGTTATCTGCAGAGGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966480564_966480569 4 Left 966480564 3:180403936-180403958 CCTACCACCCTCTGCAGATAACT No data
Right 966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966480564 Original CRISPR AGTTATCTGCAGAGGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr