ID: 966480569

View in Genome Browser
Species Human (GRCh38)
Location 3:180403963-180403985
Sequence TTCTTTTGAGAAATAACTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966480565_966480569 0 Left 966480565 3:180403940-180403962 CCACCCTCTGCAGATAACTCCTC No data
Right 966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG No data
966480567_966480569 -4 Left 966480567 3:180403944-180403966 CCTCTGCAGATAACTCCTCTTCT No data
Right 966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG No data
966480566_966480569 -3 Left 966480566 3:180403943-180403965 CCCTCTGCAGATAACTCCTCTTC No data
Right 966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG No data
966480564_966480569 4 Left 966480564 3:180403936-180403958 CCTACCACCCTCTGCAGATAACT No data
Right 966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG No data
966480563_966480569 5 Left 966480563 3:180403935-180403957 CCCTACCACCCTCTGCAGATAAC No data
Right 966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966480569 Original CRISPR TTCTTTTGAGAAATAACTCT TGG Intergenic
No off target data available for this crispr