ID: 966484705

View in Genome Browser
Species Human (GRCh38)
Location 3:180454809-180454831
Sequence GCGTCTGGTGGAAGACAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966484705_966484708 27 Left 966484705 3:180454809-180454831 CCTAGCTGTCTTCCACCAGACGC No data
Right 966484708 3:180454859-180454881 TTGACATTTTCCTGTGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966484705 Original CRISPR GCGTCTGGTGGAAGACAGCT AGG (reversed) Intergenic
No off target data available for this crispr