ID: 966485959

View in Genome Browser
Species Human (GRCh38)
Location 3:180469719-180469741
Sequence CCACCAAAGAACAACTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966485957_966485959 16 Left 966485957 3:180469680-180469702 CCAGAACTTCAGGACAGACTAAA No data
Right 966485959 3:180469719-180469741 CCACCAAAGAACAACTATAAAGG No data
966485955_966485959 29 Left 966485955 3:180469667-180469689 CCAGCTGGTGCATCCAGAACTTC No data
Right 966485959 3:180469719-180469741 CCACCAAAGAACAACTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966485959 Original CRISPR CCACCAAAGAACAACTATAA AGG Intergenic
No off target data available for this crispr