ID: 966497081

View in Genome Browser
Species Human (GRCh38)
Location 3:180593307-180593329
Sequence TGGCAGGAACAGAGTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966497081_966497087 29 Left 966497081 3:180593307-180593329 CCATGCTCACTCTGTTCCTGCCA No data
Right 966497087 3:180593359-180593381 ATCAAATACCTTCCTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966497081 Original CRISPR TGGCAGGAACAGAGTGAGCA TGG (reversed) Intergenic
No off target data available for this crispr