ID: 966497448

View in Genome Browser
Species Human (GRCh38)
Location 3:180596991-180597013
Sequence GATGGAGGAAATCTGTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966497448_966497452 -3 Left 966497448 3:180596991-180597013 CCAAACTACAGATTTCCTCCATC No data
Right 966497452 3:180597011-180597033 ATCTGGCTTAAGCAACAAAAAGG No data
966497448_966497453 -2 Left 966497448 3:180596991-180597013 CCAAACTACAGATTTCCTCCATC No data
Right 966497453 3:180597012-180597034 TCTGGCTTAAGCAACAAAAAGGG No data
966497448_966497454 10 Left 966497448 3:180596991-180597013 CCAAACTACAGATTTCCTCCATC No data
Right 966497454 3:180597024-180597046 AACAAAAAGGGACTATTTTCAGG No data
966497448_966497455 30 Left 966497448 3:180596991-180597013 CCAAACTACAGATTTCCTCCATC No data
Right 966497455 3:180597044-180597066 AGGAAAATAAAGACAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966497448 Original CRISPR GATGGAGGAAATCTGTAGTT TGG (reversed) Intergenic