ID: 966497451

View in Genome Browser
Species Human (GRCh38)
Location 3:180597009-180597031
Sequence TTTTTGTTGCTTAAGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966497451_966497454 -8 Left 966497451 3:180597009-180597031 CCATCTGGCTTAAGCAACAAAAA No data
Right 966497454 3:180597024-180597046 AACAAAAAGGGACTATTTTCAGG No data
966497451_966497456 28 Left 966497451 3:180597009-180597031 CCATCTGGCTTAAGCAACAAAAA No data
Right 966497456 3:180597060-180597082 TAATTGGAGAAGAACGAAGTTGG No data
966497451_966497455 12 Left 966497451 3:180597009-180597031 CCATCTGGCTTAAGCAACAAAAA No data
Right 966497455 3:180597044-180597066 AGGAAAATAAAGACAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966497451 Original CRISPR TTTTTGTTGCTTAAGCCAGA TGG (reversed) Intergenic