ID: 966497454

View in Genome Browser
Species Human (GRCh38)
Location 3:180597024-180597046
Sequence AACAAAAAGGGACTATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966497451_966497454 -8 Left 966497451 3:180597009-180597031 CCATCTGGCTTAAGCAACAAAAA No data
Right 966497454 3:180597024-180597046 AACAAAAAGGGACTATTTTCAGG No data
966497447_966497454 19 Left 966497447 3:180596982-180597004 CCTTTGGTTCCAAACTACAGATT No data
Right 966497454 3:180597024-180597046 AACAAAAAGGGACTATTTTCAGG No data
966497448_966497454 10 Left 966497448 3:180596991-180597013 CCAAACTACAGATTTCCTCCATC No data
Right 966497454 3:180597024-180597046 AACAAAAAGGGACTATTTTCAGG No data
966497450_966497454 -5 Left 966497450 3:180597006-180597028 CCTCCATCTGGCTTAAGCAACAA No data
Right 966497454 3:180597024-180597046 AACAAAAAGGGACTATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966497454 Original CRISPR AACAAAAAGGGACTATTTTC AGG Intergenic