ID: 966501506

View in Genome Browser
Species Human (GRCh38)
Location 3:180646753-180646775
Sequence CTGCTAGTACACAGAGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966501506 Original CRISPR CTGCTAGTACACAGAGAGCT AGG (reversed) Intronic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
903261707 1:22135098-22135120 CTGCTAGGACATCAAGAGCTGGG + Intronic
905099424 1:35505865-35505887 CAATTAGTACACAGAGCGCTTGG + Intronic
908565013 1:65345476-65345498 CTGCTGTTACACAGATAGCAAGG + Intronic
909234632 1:73136996-73137018 CTGCTAGAAGACAGAGAACCTGG - Intergenic
910375799 1:86568683-86568705 CTGTTAGTACACAGTGGACTTGG - Intronic
911231728 1:95368909-95368931 ATGCTAAGCCACAGAGAGCTAGG + Intergenic
914446295 1:147753272-147753294 CATCAAGTACACAGAGAGGTGGG - Intergenic
915481138 1:156186254-156186276 TTACTAGCACTCAGAGAGCTGGG - Intergenic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
921583143 1:216918297-216918319 CTGTATGTACACAGAGAGTTTGG + Intronic
921749347 1:218774899-218774921 CTGCTCCTACACTGAAAGCTAGG + Intergenic
922032983 1:221822266-221822288 TTGCTACTACACAGATTGCTGGG - Intergenic
923047433 1:230365780-230365802 CTGCTACTCCACATAGAGGTGGG - Intronic
923448336 1:234093469-234093491 CTGATAGTAAACAGAGAGCAGGG - Intronic
1063973851 10:11399919-11399941 CAGCAAGGACGCAGAGAGCTTGG - Intergenic
1067248032 10:44562472-44562494 CCGCTAGAACACAGAAAGCATGG + Intergenic
1071912316 10:90250299-90250321 CTGCTACTCCAAGGAGAGCTGGG + Intergenic
1072272639 10:93791718-93791740 ATGCAAATACACAGAGAACTTGG + Intronic
1072693538 10:97586956-97586978 CTGCCAGTTAACAGAGACCTTGG + Intronic
1074293623 10:112160977-112160999 CTGCTAGCACATAGAGAAGTAGG + Intronic
1075912951 10:126141678-126141700 CTTCTAGTCCACTGAGAGTTGGG - Intronic
1076424903 10:130360973-130360995 CTGTCAGTCCACAGAGAGGTGGG - Intergenic
1081556316 11:44165309-44165331 CTGCTTGTCCACAGAGAGGAAGG - Intronic
1081677866 11:44981403-44981425 CTGCTGGCACCCACAGAGCTGGG + Intergenic
1081700977 11:45152511-45152533 ATGCAAGTTCCCAGAGAGCTGGG + Intronic
1082198218 11:49328821-49328843 CTCCTATTACACTGAGACCTGGG + Intergenic
1083120361 11:60506316-60506338 TTCCCTGTACACAGAGAGCTAGG + Intronic
1084575832 11:69987319-69987341 CTGGTCATACACAGTGAGCTGGG - Intergenic
1086657595 11:89379325-89379347 CTCCTATTACACTGAGACCTGGG - Intronic
1087994246 11:104783770-104783792 CTGGGAGTATATAGAGAGCTAGG + Intergenic
1088920979 11:114259575-114259597 CTGAAACCACACAGAGAGCTGGG - Intronic
1089951938 11:122536109-122536131 CTGCTGGTCCACAGAGTGCAAGG + Intergenic
1089977913 11:122748436-122748458 CTCCGAGTGCACAGGGAGCTGGG - Intronic
1091719343 12:2801256-2801278 CTGCTGGCACACAGCCAGCTGGG - Exonic
1091986291 12:4911846-4911868 CTTCGAGTACCCCGAGAGCTCGG + Exonic
1095507348 12:42911548-42911570 CAGCTCTTACACAGAGAGGTGGG + Intergenic
1096543906 12:52323861-52323883 CTGCTAGCACAAAGTGAGGTGGG - Intergenic
1099941640 12:89196118-89196140 CTGGTAATACACAAAGAACTTGG + Intergenic
1100136710 12:91561812-91561834 CTACTATTACATAGAGATCTAGG - Intergenic
1102533852 12:113566641-113566663 TTGCTAAAACACAGAGTGCTGGG - Intergenic
1106072361 13:26424733-26424755 CTGCTAGGACACAGTGTGGTAGG - Intergenic
1106418877 13:29569189-29569211 CTGCCAGTGCCCAGAGAGCTCGG - Intronic
1106995015 13:35471159-35471181 CTGCGGGAACACAGAGGGCTGGG - Intronic
1110499808 13:76213833-76213855 TTGTTAGTACACAGACAGGTGGG + Intergenic
1112321192 13:98409365-98409387 CTGCGAGTTCACAGACAGCTCGG - Exonic
1113162866 13:107402321-107402343 CTGCTAGCAACCACAGAGCTTGG + Intronic
1116875477 14:50107140-50107162 CTACTATTCCACAGACAGCTGGG - Intergenic
1121019583 14:90571118-90571140 CTCCTAGTACACAGTGAGAGGGG - Intronic
1122105213 14:99447960-99447982 CTGGTATTTCACAGAAAGCTGGG - Intronic
1126405180 15:48315899-48315921 TTTCTAGAACACAGAAAGCTGGG - Intergenic
1126807664 15:52368314-52368336 CTGAAAGCCCACAGAGAGCTGGG - Intronic
1128389771 15:67175038-67175060 CTGTTATTACACAGCGTGCTGGG + Intronic
1128428826 15:67571763-67571785 CAGCTAGTCAATAGAGAGCTGGG + Intronic
1128511302 15:68315581-68315603 TTGCTAGCAGCCAGAGAGCTGGG + Intronic
1128619060 15:69133573-69133595 CTGCTAGTAAAGGGACAGCTGGG - Intergenic
1131433258 15:92403221-92403243 CAGCTAGTAAACATGGAGCTGGG + Intronic
1133838016 16:9383726-9383748 GTGCTAGGACAGAGAGAGATGGG - Intergenic
1137048284 16:35687988-35688010 CATCTAGTACAGAGACAGCTTGG - Intergenic
1138773534 16:59693103-59693125 CAGCTAGTACTTACAGAGCTGGG - Intergenic
1141535580 16:84677588-84677610 CTGCTATTACACACAGAACGGGG + Intergenic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1142648449 17:1330211-1330233 CTGCCAGTCCCCGGAGAGCTGGG - Intergenic
1142720648 17:1773567-1773589 CAGCTAGTACAGGCAGAGCTGGG - Intronic
1143479665 17:7221011-7221033 CTGCAAGTGCCCAGTGAGCTGGG + Exonic
1146954712 17:36930803-36930825 CTGGTGGTCCAGAGAGAGCTGGG - Intergenic
1148038697 17:44689338-44689360 CTGCAGGTACACAGAGAGGAAGG - Intronic
1148233109 17:45949526-45949548 CAGCTAGTAAGCAGAGAGCAAGG - Intronic
1149534009 17:57417996-57418018 CTCCAAGTACATAGAGAGCAGGG + Intronic
1151304451 17:73254035-73254057 CTGCTTCTACAGAGAGTGCTGGG - Intronic
1151734884 17:75933170-75933192 CTCCTAATACAGAGACAGCTTGG - Intronic
1152223439 17:79081790-79081812 CTCCTAGTACTCAGAGGGATGGG - Intronic
1158113353 18:53966516-53966538 CTGCTAGAACACTGACTGCTTGG - Intergenic
1161134977 19:2614257-2614279 CTGCGGGTACACAGAGGGCAGGG - Intronic
1163229345 19:15989727-15989749 CTGCTAGGACAGAAAGACCTGGG - Intergenic
1163258761 19:16173830-16173852 CAGCTAGTGGGCAGAGAGCTGGG - Intergenic
1163377845 19:16944632-16944654 CTGCTGGCTCACAGAGATCTCGG + Intronic
1166876086 19:45898258-45898280 CTGGTACTACACAGAGTGCTGGG + Intronic
925568776 2:5286623-5286645 CAACTTGTACATAGAGAGCTGGG + Intergenic
926786465 2:16522971-16522993 GTGCTAGTGCTTAGAGAGCTGGG + Intergenic
932208879 2:69910250-69910272 CTTCTATTAGACAGTGAGCTCGG + Intronic
932215679 2:69964504-69964526 CTGGAAGCACACAGAGACCTTGG + Intergenic
935052504 2:99535827-99535849 GTGCTGGAACACAGAGAGCAGGG - Intergenic
937626273 2:124047399-124047421 TCACTGGTACACAGAGAGCTTGG + Intronic
941324689 2:164099093-164099115 CTGCTGGCACACAGAGAGAATGG + Intergenic
942789578 2:179744568-179744590 CTGCCAGTACACGTAAAGCTTGG - Intronic
948687642 2:239679063-239679085 ATGGAAGGACACAGAGAGCTGGG - Intergenic
1168819996 20:766233-766255 CTGCTAATAAAAAGACAGCTTGG - Intronic
1170333286 20:15239645-15239667 CTGCTAGTATACTGGGAGCAGGG - Intronic
1171215206 20:23347426-23347448 CTGCCAGTTCAGAGTGAGCTGGG - Intergenic
1175707172 20:61188294-61188316 CTGGGAGAACACAGAGTGCTAGG - Intergenic
1179766669 21:43578838-43578860 CTGCCAGGCCACAGAGACCTGGG - Intronic
1185019012 22:48362667-48362689 CTGTGAGCACACAGAGGGCTAGG - Intergenic
1185352962 22:50347539-50347561 CTGCGAGTACACAGAGTGGCAGG - Intronic
950704043 3:14769213-14769235 CTGCTAGAGCTCAGAGGGCTTGG + Intronic
952609644 3:35192658-35192680 CTGCAGATACACAGAGAGCATGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
956701300 3:71961386-71961408 CTGCTAGTACACAGAAAAGTGGG + Intergenic
961945265 3:130680282-130680304 CAGCTAGTAAACAGAAAGCTGGG - Intronic
963772120 3:149397694-149397716 CTGACAGGACACAGAGAGTTAGG + Intergenic
966080117 3:175989900-175989922 CTGCTAGGCCAGGGAGAGCTAGG - Intergenic
966088958 3:176107309-176107331 CTGCGTGTACACAGGGAGATGGG + Intergenic
966501506 3:180646753-180646775 CTGCTAGTACACAGAGAGCTAGG - Intronic
969966033 4:10996472-10996494 CTGGTACTGCAGAGAGAGCTGGG + Intergenic
971523101 4:27580184-27580206 CTGCTAGTACACAGAGCAGCTGG + Intergenic
975273995 4:72473729-72473751 CTGATAGTACACAGTGTACTAGG - Intronic
976196872 4:82540957-82540979 CAGCTAGTAGAGACAGAGCTGGG - Intronic
977117884 4:93055267-93055289 CTGCTAGACCACAGAGAGAGGGG - Intronic
979218433 4:118193588-118193610 CTGCTGGCACACAGCCAGCTGGG + Intronic
982483752 4:155941975-155941997 CTGCTATTGTACAGAAAGCTTGG + Intronic
985329640 4:188817030-188817052 AAGGTAGTATACAGAGAGCTAGG - Intergenic
985692592 5:1321764-1321786 CTTGTAGTTCACAAAGAGCTGGG + Exonic
987218841 5:15768681-15768703 ATGATAGTACACACAGAGCGTGG + Intronic
991556701 5:67902724-67902746 CAGCTATTACACATAGGGCTGGG - Intergenic
995159339 5:108959555-108959577 TTGCTAGTATACAGATGGCTTGG + Intronic
997913736 5:137902729-137902751 CTGCTTGTACACAGACATCTTGG + Intronic
998487087 5:142512265-142512287 CTGGTAGCACACATAGAGCTGGG - Intergenic
1000076182 5:157789321-157789343 CTGCAAGTACACAAAGAAGTGGG + Intronic
1002863659 6:1102176-1102198 CTGCTGGGTCCCAGAGAGCTAGG - Intergenic
1004700920 6:18078743-18078765 CTGCTAGAACACAAAAATCTAGG - Intergenic
1008897821 6:56578013-56578035 CTTCTAGAACACAGAGAAGTGGG - Intronic
1010800807 6:80173576-80173598 CTACTAACACAAAGAGAGCTGGG - Intronic
1013735650 6:113223511-113223533 GTGTTAGCAGACAGAGAGCTTGG + Intergenic
1014855446 6:126395904-126395926 CTGCTGGGCCACATAGAGCTGGG + Intergenic
1015171973 6:130264228-130264250 GGGATAGAACACAGAGAGCTTGG - Intronic
1016029899 6:139326499-139326521 CAGCTATTACACAGAAAGCTGGG - Intergenic
1016838096 6:148499488-148499510 GTCCTTGTACACAGGGAGCTTGG + Intronic
1018502499 6:164426195-164426217 CTGCAAGAAAACAGAGGGCTAGG - Intergenic
1021774515 7:24039294-24039316 CTGCCAGGACACAAAGACCTTGG + Intergenic
1023057754 7:36303407-36303429 CAGCTATGACACAGAGAGCTGGG - Intergenic
1025850319 7:65239053-65239075 CAGATAGCACACAGAGCGCTTGG + Intergenic
1027873160 7:83735765-83735787 ATGCTAGAACACAGATTGCTGGG + Intergenic
1031357024 7:120799217-120799239 CTACTAATAACCAGAGAGCTGGG + Intronic
1032486694 7:132293012-132293034 TTGCTGGTACACGGAGAGCCAGG + Intronic
1032567986 7:132968068-132968090 CTGCTACTCCACAGAAAACTTGG + Intronic
1032684697 7:134221239-134221261 CTGCTCATTCACAGAGGGCTAGG - Intronic
1034452870 7:151146900-151146922 CAGCTAGGACACACAGAGCTAGG - Intergenic
1038507651 8:28099402-28099424 CTGGTAGTACATAGAGACCAAGG + Intronic
1042430321 8:68699119-68699141 CTTCTAGAACACAGATTGCTGGG - Intronic
1043110026 8:76169261-76169283 CTACTAGTAAAAAGAGGGCTGGG + Intergenic
1043357725 8:79432912-79432934 CAGCTAGTACACAGAGATCTAGG - Intergenic
1043451938 8:80376517-80376539 GTGCTAGTACACAAAGGGCCTGG + Intergenic
1044373814 8:91445971-91445993 CTTCTAGCACACAGGGATCTGGG + Intergenic
1049282637 8:141758201-141758223 CTCCTAGTAACCAGAGGGCTAGG - Intergenic
1049414957 8:142490920-142490942 ATGCGGGTACACAGACAGCTGGG - Intronic
1050135017 9:2453533-2453555 TAGCTATTACACATAGAGCTGGG - Intergenic
1050217053 9:3338588-3338610 CTGTTGCAACACAGAGAGCTAGG + Intronic
1053287677 9:36860395-36860417 ATACTAGTTCACAGGGAGCTCGG + Intronic
1053608934 9:39690777-39690799 CTGGTAGGAAAGAGAGAGCTGGG - Intergenic
1054244588 9:62651621-62651643 CTGGTAGGAAAGAGAGAGCTGGG + Intergenic
1056428946 9:86507476-86507498 TGGCCAGTACACAGAGACCTGGG + Intergenic
1056703166 9:88927386-88927408 CTGCCAGCAGCCAGAGAGCTTGG + Intergenic
1060177151 9:121505526-121505548 GTGCTGGCCCACAGAGAGCTTGG + Intergenic
1061059158 9:128242112-128242134 CTGCCAGGCCTCAGAGAGCTGGG + Intronic
1061845454 9:133385645-133385667 CTCCTGGTACACAGAGATGTGGG - Exonic
1062606516 9:137351033-137351055 CTGCTGGTGCACAGACAGGTGGG - Exonic
1186466907 X:9790371-9790393 CTGATATTTCACAAAGAGCTTGG - Intronic
1187035510 X:15534934-15534956 CTGCTAATCAACAGAGGGCTAGG - Intronic
1187790095 X:22941384-22941406 CTGCAAATATAGAGAGAGCTGGG + Intergenic
1189047420 X:37608317-37608339 TTGCTAATACACAGATTGCTGGG + Intronic
1189108967 X:38267174-38267196 CTGCTAGCACCCAGTGAGCCTGG - Intronic
1195273822 X:103258919-103258941 CAACTAGTACACACAGAGCCTGG + Intergenic
1201751262 Y:17434578-17434600 TTGATAATACACAGAGAGATAGG - Intergenic
1202336254 Y:23813846-23813868 TGGCTGGTACACAGAGTGCTTGG - Intergenic
1202534512 Y:25856221-25856243 TGGCTGGTACACAGAGTGCTTGG + Intergenic