ID: 966504049

View in Genome Browser
Species Human (GRCh38)
Location 3:180679340-180679362
Sequence GCTGAGCTGCACTGGGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966504049_966504055 7 Left 966504049 3:180679340-180679362 CCATCCTCCCAGTGCAGCTCAGC 0: 1
1: 1
2: 6
3: 32
4: 383
Right 966504055 3:180679370-180679392 TCGCTACTCATGACTGCAAACGG 0: 1
1: 0
2: 1
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966504049 Original CRISPR GCTGAGCTGCACTGGGAGGA TGG (reversed) Exonic
900109187 1:998484-998506 CCTGAGCGGCGCTGGGATGAGGG - Intergenic
900290398 1:1921282-1921304 GGTGTGCTGCACTGACAGGAGGG + Intergenic
901009568 1:6192152-6192174 GGGGAGCTGAAGTGGGAGGATGG - Intronic
901496710 1:9626507-9626529 GCAGAGCTGGGCAGGGAGGAAGG + Intergenic
901798012 1:11691700-11691722 GCTGAGCGGGACTGGAAGGAAGG - Intergenic
902383516 1:16063802-16063824 GCTGAGGGGCACAGGCAGGAGGG - Intronic
903848090 1:26290415-26290437 GCTGTGCTGCTCTGTGGGGAGGG - Intronic
904120375 1:28194108-28194130 GCTGCGCCCCTCTGGGAGGAAGG + Intergenic
904948113 1:34214179-34214201 AGTGAGCAGCACTGGGAGGAGGG + Intronic
904968609 1:34401041-34401063 GCTGAGCTTCACCACGAGGATGG + Intergenic
905405046 1:37726880-37726902 GCTCAGCTGCTCTGGGATGAAGG - Intronic
906156187 1:43615353-43615375 GCAGGGCTGCGCTGGAAGGAAGG - Intronic
906244244 1:44262061-44262083 GCTGGGCTGCGGTGGGTGGAGGG - Intronic
906612699 1:47214270-47214292 ACTGAGCTGTCCTGGGAGGTGGG + Intergenic
907108547 1:51905965-51905987 GTGGAGCTGCACTAGGAGAAAGG - Intergenic
908320822 1:62977092-62977114 ACAGAGCTTCATTGGGAGGAAGG + Intergenic
908695185 1:66831956-66831978 ACTGATGTGCACTGGGAGGGTGG + Intronic
912543383 1:110433632-110433654 GCTGAGCTGGGCTGGGTGGAAGG + Intergenic
912812754 1:112806283-112806305 GCTGAACTGCACTGGCATCATGG + Intergenic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
915597185 1:156902379-156902401 GCTGGGCTGCACTGGAGGGGTGG + Intronic
915964536 1:160294767-160294789 GCAGAGCTGCAGTTGGATGAAGG - Exonic
916084484 1:161258742-161258764 GCTGAGCGGCTCTGACAGGACGG + Exonic
917973945 1:180226884-180226906 GCTGAGCTGCACTGTGTGTGTGG + Intergenic
918109895 1:181446250-181446272 GCTGTGCTGCAAGGGCAGGATGG - Intronic
918266205 1:182844444-182844466 GAAGAGCTGAAGTGGGAGGATGG - Intronic
919748869 1:201024425-201024447 CCTGAGCTGCCCTGGGGGAAAGG + Intergenic
919755739 1:201065039-201065061 GCTGTGGGGCCCTGGGAGGAGGG + Intronic
919920912 1:202165929-202165951 GCTGAGCTGGTCTTGGAGGCAGG + Intergenic
919989622 1:202700210-202700232 CCAGAGCTGCACGGGGTGGAGGG - Intronic
920067751 1:203281238-203281260 GCTGGGCTGGGCTGGAAGGAGGG - Intergenic
920998032 1:211013828-211013850 GCTGCACTGAACTGGGAGGACGG - Intronic
921431108 1:215067076-215067098 GCTGGGCTGAACTGGGACTATGG + Intronic
922554474 1:226522224-226522246 GCTGAGCTGGGCTGGGTGCAGGG - Intergenic
923035008 1:230279656-230279678 GCTGGGCTGCACCGAGAGGAGGG - Exonic
923287922 1:232514762-232514784 GCTGCCCTGCACAGGGAGTATGG - Exonic
923613495 1:235516828-235516850 CCTGAGCGACACTGGGAGGCTGG - Intergenic
924406961 1:243758153-243758175 TCTGACAGGCACTGGGAGGATGG + Intronic
924603363 1:245510828-245510850 GCTGAGCTGCACTGGGAAGGTGG + Intronic
1062838658 10:652537-652559 ACGGAGCTGCAGTGGGAGGCGGG + Exonic
1062886630 10:1021309-1021331 GCTGGGCTGCACTTTGAGGGTGG + Intronic
1064072420 10:12242228-12242250 ACAGAGATGCCCTGGGAGGAGGG - Intronic
1064137204 10:12761415-12761437 GCGGAACTGCACCGGGAGGAGGG - Intronic
1064839576 10:19575732-19575754 ACTGAGCTGTACTGAGAGTAAGG - Intronic
1065756226 10:28933958-28933980 GCTGAGTGGCAATGGGAAGATGG - Intergenic
1066296680 10:34060117-34060139 GCTGAGCAGCCTGGGGAGGAAGG + Intergenic
1067035523 10:42913351-42913373 GCTGAGATGCACTGACAGAATGG - Intergenic
1067146821 10:43700358-43700380 GCTGAGCTGAGCTGGGTGTAAGG - Intergenic
1067568516 10:47354869-47354891 GTGGAGCTGCATTGGGAGCAGGG - Intronic
1069415257 10:68194533-68194555 GCTGTGCTGCACTCTGAGGAAGG + Intronic
1069680853 10:70284095-70284117 CCAGGGCTGCAGTGGGAGGAGGG - Intergenic
1069852344 10:71417712-71417734 GAGAGGCTGCACTGGGAGGATGG - Intronic
1070570942 10:77638694-77638716 GGTGGGGTACACTGGGAGGACGG + Intergenic
1070774021 10:79099526-79099548 CCTGTGCTGCACTGGGAACAGGG + Intronic
1071295538 10:84216828-84216850 GCCGGGCTGCACTGGTAGGGTGG - Exonic
1071505516 10:86229259-86229281 GCTCCTCTGCCCTGGGAGGAGGG - Intronic
1071598407 10:86944058-86944080 GCTGAAATGCACTTGTAGGAAGG + Exonic
1071830063 10:89362721-89362743 CCTGAGATGAACTGTGAGGAAGG + Intronic
1072895060 10:99359591-99359613 GAAGAGCTGCACCGGCAGGAGGG + Intronic
1073603518 10:104870501-104870523 GCTGAGGTGCAAGGGGTGGATGG - Intronic
1074207208 10:111293553-111293575 ACTGTGCTGCACTGGGAGTCAGG - Intergenic
1074989721 10:118692933-118692955 TTTGAGCTGGACTGGAAGGAGGG - Intronic
1075719948 10:124578769-124578791 GCTGGGCTGCACTGGATGGTGGG - Intronic
1076323783 10:129604672-129604694 GCAGTGGTTCACTGGGAGGAGGG + Intronic
1076546890 10:131251314-131251336 TCTGAGCTGGGCTGGGAGGAGGG - Intronic
1076810473 10:132884069-132884091 GCTGAGCTGCACTGGGCCTCGGG - Intronic
1076921454 10:133456631-133456653 GCAGAGGAGGACTGGGAGGATGG + Intergenic
1077252487 11:1566753-1566775 GCGGGGCAGCCCTGGGAGGAGGG + Intronic
1077373250 11:2193493-2193515 GCTCCGCTCCACTGGGAGGTAGG + Intergenic
1078895283 11:15592020-15592042 GCTGGGCTTCACATGGAGGAAGG + Intergenic
1080889667 11:36398455-36398477 CCAGAGCAGCACAGGGAGGAAGG - Intronic
1081705127 11:45178436-45178458 GCAGAGGTGCACTGGGGGGTAGG - Intronic
1081754187 11:45532903-45532925 CTTGAGCAGCTCTGGGAGGAAGG - Intergenic
1081814970 11:45933999-45934021 GCTGTGCAGCTCTGGGAGGAGGG + Exonic
1081889675 11:46530357-46530379 CATGACCTGCACTGGGAGAAGGG + Intronic
1083448857 11:62728870-62728892 GCTCAGCTGTACAAGGAGGAAGG + Exonic
1083631355 11:64097117-64097139 GCTCAGCTGCACTGTGAGGACGG + Intronic
1085457268 11:76672121-76672143 CCTGAGCTGCAGTGAGGGGATGG + Intergenic
1085506855 11:77065938-77065960 GCTTTGCTGCACTGGGTGGGCGG + Intergenic
1088322697 11:108569863-108569885 GCTGTGAGGCACTGGCAGGAGGG + Intronic
1088817939 11:113434093-113434115 TCTGAGCTGGAGTGGCAGGAAGG - Intronic
1089146368 11:116332239-116332261 GCTGAGCTGGACTGGGAGCAAGG + Intergenic
1089462504 11:118661363-118661385 GCAGAGCAGCACAGGGAGGGTGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090236903 11:125154912-125154934 ACTGTGCTGCACAGGGAGGGTGG - Intergenic
1090457782 11:126864864-126864886 GATGAGCTGCATGGGAAGGATGG - Intronic
1091054549 11:132405946-132405968 CCTGAGCTGCACTGGTGGGGAGG + Intergenic
1091224008 11:133946915-133946937 GCAGAACTGTGCTGGGAGGAGGG - Intronic
1091490297 12:926815-926837 GCTGAGGAGCACGGAGAGGAGGG + Intronic
1091781514 12:3216978-3217000 CCTGAACTGCAGTTGGAGGAAGG + Intronic
1091840619 12:3617859-3617881 GGAAAGCTGCACTGGGAGCATGG - Intronic
1092149303 12:6236132-6236154 GAGGAGGTGCCCTGGGAGGAAGG + Intronic
1092307706 12:7318581-7318603 GAGGAGCTGCTCTGGGAGAAAGG - Intronic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1093704798 12:22262605-22262627 TCTGAGCTGGTCTGGGAGGCAGG + Intronic
1094646258 12:32327620-32327642 GCTGAGCTGGACGGGGAGAAGGG + Exonic
1095949505 12:47773993-47774015 GCTGAGACCCACAGGGAGGACGG + Intronic
1096216689 12:49801659-49801681 GGTGGGGAGCACTGGGAGGAGGG + Intronic
1096441547 12:51647853-51647875 GCAGCTCTGCACTGGGAGGAAGG - Intronic
1096521419 12:52186834-52186856 GCTGGGCTGGACTGGGTAGAAGG - Intronic
1096798290 12:54092177-54092199 GGTGAGCATCACTGGGAGGGAGG - Intergenic
1097195775 12:57241831-57241853 GCTGTGCTGAACTAGAAGGAGGG - Intergenic
1100439247 12:94600588-94600610 GCTGAGATCCACTTGGTGGATGG - Intronic
1100841721 12:98619765-98619787 GCCGGGCTGAGCTGGGAGGATGG + Intronic
1101413296 12:104486803-104486825 GTTCAGCTGCAATGGGAGTAGGG - Intronic
1101987558 12:109459609-109459631 GATGAACTGTACTGGGAGAATGG + Intronic
1102257794 12:111426168-111426190 CCTGCCCTACACTGGGAGGAAGG - Intronic
1102495589 12:113316809-113316831 CCTGAGCTGCAGTGAGAGGTGGG + Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104895097 12:132160129-132160151 GCTGAGCAGAGCTGGGAGCAGGG - Intergenic
1105213927 13:18273600-18273622 GCTGACCTGCTCTGGGAGGAAGG - Intergenic
1105302627 13:19150046-19150068 GCTGAGATGGACTGGGACCATGG - Intergenic
1105571548 13:21607820-21607842 TGGGAGCTGCACTGCGAGGAAGG - Intergenic
1106200158 13:27529152-27529174 GCTGTGCTCCACTGGGTGAATGG + Intergenic
1108360072 13:49661133-49661155 GGTGAGCCACTCTGGGAGGAAGG + Exonic
1108712045 13:53043248-53043270 GCTTACCTGGAGTGGGAGGAGGG - Exonic
1111431563 13:88152853-88152875 GCTGAGCCCCACTGGGTGGCTGG - Intergenic
1113102156 13:106732583-106732605 CCTCAGCTGCACTGGATGGATGG + Intergenic
1113589240 13:111486613-111486635 TGGGAGCTGGACTGGGAGGAGGG - Intergenic
1113594951 13:111524634-111524656 GCTGAGAGGGGCTGGGAGGATGG - Intergenic
1113942074 13:114023540-114023562 GCTTATTTTCACTGGGAGGAGGG + Intronic
1115961223 14:38837547-38837569 GCTGAGCGTGGCTGGGAGGATGG - Intergenic
1116093760 14:40341043-40341065 TCTGAACTTCACTGGGAGGTGGG + Intergenic
1117073654 14:52079050-52079072 ACTGGGCTGCACTGGAAGGCGGG - Intergenic
1117770010 14:59124701-59124723 GGTGAGCTGAATTGGGAGCAAGG - Intergenic
1118221701 14:63860329-63860351 TCTGGGCTGCATTAGGAGGAGGG + Intronic
1118348583 14:64957723-64957745 GCTGAGCTGGACTGGAAAGCTGG + Intronic
1118373796 14:65159480-65159502 GCGAAGCTGCAGTGGCAGGATGG - Intergenic
1118759551 14:68871673-68871695 GCTGGGCTGCAGGGAGAGGAGGG + Intergenic
1120400335 14:84022988-84023010 GCTGAGCTGCTCTGGGGGTGGGG + Intergenic
1121427029 14:93859726-93859748 ACTGACCTGAACAGGGAGGAAGG - Intergenic
1122016901 14:98803910-98803932 TCACAGCTGCTCTGGGAGGAGGG + Intergenic
1122141787 14:99667092-99667114 GCTCAGCTGGACTGGGGGCAGGG - Intronic
1122482617 14:102056878-102056900 GCTGAGCTGCAGCGGGAGTTGGG - Intergenic
1124094666 15:26637968-26637990 TGTAAGCTGCACTTGGAGGATGG - Intronic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1127925583 15:63537604-63537626 GTGGAACTGCACTGGGAGAAGGG - Intronic
1128183552 15:65625321-65625343 ACTGAGCTCCTCTGGGAGCAGGG - Exonic
1128550367 15:68594440-68594462 GGTGAGCAGCCCTGGCAGGAAGG + Intronic
1129153360 15:73702873-73702895 GCTGAGGTGTTCTGGCAGGATGG + Exonic
1129153673 15:73704277-73704299 GCTGAGGTGTTCTGGCAGGATGG + Exonic
1129261214 15:74368468-74368490 GCTGACCTGGGCTGGAAGGATGG - Intergenic
1129756312 15:78101274-78101296 GCAGAGCTGCCCTGGGAGCAGGG - Exonic
1131111864 15:89769464-89769486 GCGGATGTTCACTGGGAGGAAGG - Intronic
1131235734 15:90695466-90695488 GCTAGGCTGAAATGGGAGGATGG - Intergenic
1132119697 15:99166348-99166370 GCTGAGCTGCACTGAGGGAAAGG - Intronic
1132149106 15:99447269-99447291 GCTGAGCTGGGCTGGGGGCAGGG - Intergenic
1132338028 15:101061219-101061241 GATGTGCTGCCCTGGGATGAAGG + Exonic
1132909875 16:2303999-2304021 GCCGAACTGCCCTGGGAAGACGG + Exonic
1133117751 16:3587868-3587890 GCTGAGCATGACTGGGAGAAAGG - Intronic
1133598523 16:7316720-7316742 GCTGAGATGGAGTGGGAGGTAGG + Intronic
1134211330 16:12279912-12279934 ACTGAGCTGCACTGGTCTGATGG - Intronic
1134814501 16:17194666-17194688 GCAGAACTGGACTGGCAGGATGG - Intronic
1135543997 16:23353794-23353816 ACTGCCCTGCACTGGGAGGCTGG + Intronic
1136421664 16:30138126-30138148 CCTGCGCTGCAGTGGCAGGAGGG + Intergenic
1137479438 16:48839587-48839609 GATGATTTGCACTGGGAAGAAGG + Intergenic
1138247454 16:55478464-55478486 GCTGGGCTGCACTCCCAGGAGGG - Intronic
1138880308 16:61006220-61006242 GCTGAGGAGCTCTGTGAGGAGGG - Intergenic
1139140852 16:64260736-64260758 GGTGAGCCACTCTGGGAGGAAGG + Intergenic
1139592343 16:67940286-67940308 GCAGACCTGCACTTTGAGGAAGG - Exonic
1139601861 16:67992183-67992205 GCTGACCAGAACTGGGGGGAAGG + Exonic
1139635927 16:68258406-68258428 CCTGATCAGCACTTGGAGGATGG + Intronic
1141198719 16:81881141-81881163 GGTGTGGAGCACTGGGAGGATGG + Intronic
1142214606 16:88824455-88824477 GCTCAGATGCCCTGGCAGGATGG + Intronic
1142302031 16:89264481-89264503 GCTGAGCTGCCCAGGTGGGAAGG + Intergenic
1143378157 17:6479417-6479439 TCTGAGCTGCCCAGAGAGGAGGG - Intronic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1144829742 17:18124519-18124541 CGTGAGCAGCACGGGGAGGATGG + Exonic
1145884171 17:28371420-28371442 CCTGCGCTGGACTTGGAGGAAGG - Intronic
1146831787 17:36075906-36075928 GCGGAGTGTCACTGGGAGGATGG - Intergenic
1147714211 17:42493398-42493420 GCTGGCCTGCCCTGGGAGCAGGG + Intronic
1148018111 17:44536743-44536765 ACCCAGCTGCCCTGGGAGGAAGG - Intergenic
1148461861 17:47843603-47843625 GAGGAGCTGCATGGGGAGGAGGG + Intergenic
1148565919 17:48632984-48633006 TCAGAGCTACACTGGGAGGCTGG - Intronic
1149037699 17:52154544-52154566 TCTGAGCTGCTTTGGTAGGAAGG + Intronic
1149684852 17:58529398-58529420 GCTGAGCTGTCCTTGGAGGGTGG - Intronic
1150495409 17:65604317-65604339 CATGAGATCCACTGGGAGGAAGG + Intronic
1150524916 17:65912450-65912472 GCTAAGGTGCACTGGTGGGAGGG - Intronic
1152371886 17:79893392-79893414 GCTGTGGAGCACAGGGAGGAAGG - Intergenic
1152423693 17:80207743-80207765 TCTGAGCTGCTCTTGGGGGAGGG - Intronic
1154465860 18:14642336-14642358 GCTCGGCTGGACTGGTAGGAGGG - Intergenic
1156857863 18:41803577-41803599 GCTGAGCTGCATGGGAAGAAAGG - Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1158402142 18:57130873-57130895 TATCAGCTACACTGGGAGGAGGG + Intergenic
1158452622 18:57580726-57580748 GGTGGGGTGCAGTGGGAGGAGGG - Intronic
1158593289 18:58795354-58795376 GGGAAGCTGCAGTGGGAGGATGG - Intergenic
1158619728 18:59022586-59022608 GCTGAGCTGACGTGGGTGGATGG + Intergenic
1160062817 18:75548399-75548421 GCTGAGCTGAGCTGGGGGGAAGG - Intergenic
1160316296 18:77850909-77850931 GCTGAGCAGAGCTGAGAGGATGG + Intergenic
1160521029 18:79508162-79508184 ACTCAGCTGCACTGGGAGTCTGG - Intronic
1160703155 19:517849-517871 GCTGGGCGGTGCTGGGAGGAGGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163643938 19:18477727-18477749 TCTGGCCTGCACTGTGAGGAAGG + Intronic
1163797777 19:19347263-19347285 GGTGAGCTGGAATGGGAGGCGGG - Exonic
1164156339 19:22599804-22599826 GCTGGGGTGACCTGGGAGGAGGG + Intergenic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1165397910 19:35577259-35577281 GAGCAGCTGCACTGGGATGAAGG + Intergenic
1165711248 19:38012472-38012494 CCTGAGCTGGGCTGGGAGCAGGG - Intronic
1165789378 19:38482399-38482421 GATGGGCTCCACTGGGAAGACGG + Intronic
1166683792 19:44782976-44782998 GCTGAGGTGCAGGGGTAGGACGG + Intronic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
1167509230 19:49887613-49887635 GCTCACCTGCCCTGGGAGGTTGG + Intronic
1167669246 19:50840003-50840025 GCTTTCCTGCACTGGGAGGTGGG - Intergenic
1168233817 19:55049432-55049454 GCTGAGTGGTACAGGGAGGAAGG - Intronic
1168300545 19:55402383-55402405 GCTGAGGTGCACTTCGAGGGTGG + Intronic
1168524223 19:57075930-57075952 GCTGAGAGGCACTCAGAGGATGG - Intergenic
925033438 2:669525-669547 TGGGAGCTGCACTGGGTGGACGG + Exonic
925055344 2:852990-853012 CCTGAACTCCACAGGGAGGAGGG + Intergenic
925948579 2:8889930-8889952 AGTAAGCTGCGCTGGGAGGACGG + Intronic
926627230 2:15102361-15102383 GCAGAGCTGTCCTGGGTGGAGGG - Intergenic
926907186 2:17816711-17816733 GCTGGGCTGCCCTGTGAGCACGG + Exonic
927700867 2:25268077-25268099 GCTGGGCAGCCCTGGGCGGAGGG + Intronic
927714600 2:25343322-25343344 GCTGGGCTGCATGGGGAGAAGGG - Intergenic
927919639 2:26961996-26962018 CCTGAGCTGCTCTGGGGGCAGGG - Intergenic
928000861 2:27522049-27522071 GCTGAGCTAGACAGAGAGGAGGG + Intronic
928345647 2:30492324-30492346 ACTGAGCTGGACTTGTAGGATGG + Intronic
928401439 2:30981503-30981525 GGTGACCTGCACTGCGTGGAGGG + Intronic
934300397 2:91773149-91773171 GCTGACCTGCCCTGGGAGGAAGG + Intergenic
935563130 2:104578741-104578763 GTCCATCTGCACTGGGAGGAGGG + Intergenic
935686554 2:105688972-105688994 GCACAGCTGCCCTGGGTGGAGGG - Intergenic
936507325 2:113117872-113117894 TCTGAGGTGCTCTGGAAGGAGGG + Intronic
938727905 2:134122825-134122847 GGTGAACTGCAATGGCAGGAGGG + Intronic
939085035 2:137708439-137708461 GCAGAGTAGCACTGGGAGCAGGG + Intergenic
942153953 2:173107472-173107494 GCTGACCTGCACAGGGATAAGGG + Intronic
943208218 2:184928081-184928103 GCTGAGTTTCACTGGGAGCCAGG + Intronic
944289718 2:197991693-197991715 GCAGTCCTGCACTGGGAGAAAGG - Intronic
944534522 2:200696032-200696054 GCGGAGCTGCTCTGGGAGACAGG - Intergenic
947636889 2:231684758-231684780 GCTGAGCTTCATGGGGAGCAGGG + Intergenic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948575015 2:238944204-238944226 GCAGGGCTGCAGGGGGAGGAAGG + Intergenic
948645931 2:239404549-239404571 GCTGATCTTCACAGGCAGGAGGG + Intergenic
948798503 2:240419438-240419460 GCTCAGGTGCTCTGGGAGGTGGG - Intergenic
949077319 2:242069188-242069210 GCTGAGGGGCACTGGGAAGGAGG - Intergenic
1169195757 20:3681374-3681396 GCCCTGCTGCCCTGGGAGGAGGG + Intronic
1169291388 20:4356013-4356035 GATAAGGAGCACTGGGAGGAAGG - Intergenic
1169381037 20:5107372-5107394 TCAGAGCTGCACTGGGTGGTAGG - Intronic
1169388750 20:5172634-5172656 TCAGAGCAGTACTGGGAGGAAGG - Intronic
1169872165 20:10259641-10259663 GGGGAGCTGAAGTGGGAGGATGG - Intronic
1170678928 20:18507902-18507924 GCTGAGCTGGACTTGGCGGTGGG + Exonic
1171850120 20:30301997-30302019 GGTGAGCATCACTGGGAGGGAGG - Intergenic
1172427546 20:34865287-34865309 GCTGAGCTGAGGTGGGAGGATGG - Intronic
1173728790 20:45314396-45314418 GATGATCTGCAATGGAAGGATGG - Exonic
1174562747 20:51443141-51443163 CCTGAGCTGCACCTGAAGGATGG - Intronic
1174845916 20:53943084-53943106 TCTGGGCTGCCCTGGGAGGTGGG - Intronic
1175414176 20:58790647-58790669 GATGCCCTGCACTGGGAGGCAGG + Intergenic
1175482924 20:59324170-59324192 GCTGAGAAGCACTGGGAAGAGGG + Intronic
1175644230 20:60657757-60657779 GCTGAAATGCACTGTGAGAAAGG - Intergenic
1175766172 20:61594278-61594300 GCTGAGCTGAGCAGGGAAGAAGG + Intronic
1176233011 20:64041597-64041619 CATGTGCCGCACTGGGAGGAGGG + Intronic
1176310128 21:5145049-5145071 GCTGGACTCCAGTGGGAGGAGGG - Intronic
1176808727 21:13516258-13516280 GCTCGGCTGGACTGGTAGGAGGG + Intergenic
1177230576 21:18315166-18315188 GGTCATCTGCACTGTGAGGATGG - Exonic
1178561511 21:33642935-33642957 GCGGACCCGCACTGGGAGGCCGG + Intronic
1179846928 21:44116987-44117009 GCTGGACTCCAGTGGGAGGAGGG + Intronic
1179966142 21:44807176-44807198 GCTGAGCTGCAGTGAGGGGACGG - Intronic
1180592651 22:16954313-16954335 ACGGGGCTGCAGTGGGAGGAGGG + Intergenic
1180968000 22:19800535-19800557 GCTGAGCTGCTCTGGGCGCTGGG - Intronic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1181698755 22:24608282-24608304 GCTGACCTGCCCTGGGAGGAAGG + Intronic
1183232337 22:36590831-36590853 GCAGAGATGCACAGGGAGGGAGG - Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184507675 22:44914101-44914123 GGTGAGGGGCACAGGGAGGAAGG + Intronic
1184883942 22:47330717-47330739 CCTGAGCTGTGCTGGGAGCAGGG - Intergenic
1184896158 22:47408072-47408094 GCTATGATGCACTGGGAAGAGGG + Intergenic
1185011823 22:48318844-48318866 GCTCTGGTGCAGTGGGAGGAGGG - Intergenic
949534374 3:4984405-4984427 GCTGAGCTGCCCCGGAGGGAGGG + Exonic
950158393 3:10740999-10741021 GCTGAGCAGCAGCGGTAGGAAGG - Intergenic
950503777 3:13380700-13380722 CCTGAGCTGGCCTGAGAGGAGGG - Intronic
950549953 3:13660195-13660217 ACTGGGCTGGACTGGGAGGGAGG + Intergenic
950710687 3:14810974-14810996 GCCGAGCGGCACTGGAAGGTCGG - Intergenic
951779589 3:26347456-26347478 GCAGACCTGCGCTGTGAGGAAGG + Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952428978 3:33203488-33203510 GGTGAGCTGCTCTGGGACGCAGG + Intronic
952711483 3:36436497-36436519 TCTGAGAAGCACTGGGAGGTCGG - Intronic
952749745 3:36815639-36815661 GCTGGGCAGCCCTGGGAGGTGGG + Intergenic
953411321 3:42691947-42691969 ATTGAGCCGCACTGGTAGGAAGG - Exonic
953982587 3:47420103-47420125 GCTGAACTGAGATGGGAGGAAGG - Intronic
954312432 3:49780547-49780569 TCAGGGCTGCACTGGGAGGAGGG + Intronic
954409273 3:50363334-50363356 GCTCAGATGGACTGGGAGGAGGG - Intronic
954464908 3:50648637-50648659 GCTGGACTGCACAGGGAGGCAGG - Exonic
955004371 3:54955253-54955275 GCAGAGCTGCACAGGGACAAAGG + Intronic
956045318 3:65189949-65189971 GCTGATCTGCTCTGGTGGGAGGG - Intergenic
956378907 3:68645125-68645147 CCTGAGCTGCAGGGGGAGTAAGG - Intergenic
958769909 3:98413947-98413969 GCTGAGCTCCACTTGGAGCCAGG + Intergenic
960157498 3:114310901-114310923 GCTGAGCTGGACAGGCAGGGAGG + Intergenic
960974821 3:123163526-123163548 GAAGAGCTGAACTGGCAGGAGGG - Intronic
961470408 3:127107765-127107787 GCTGAGCAGGTCTGGGAGGTGGG - Intergenic
961987927 3:131157698-131157720 GCTGGGCTGAAGGGGGAGGAAGG + Intronic
963997023 3:151721488-151721510 GCTGACAGGCACTGGCAGGATGG - Intergenic
966504049 3:180679340-180679362 GCTGAGCTGCACTGGGAGGATGG - Exonic
966808486 3:183824619-183824641 GCAGAGCTGGGCTGGGAGGTGGG + Intronic
966860697 3:184229802-184229824 GCAGAGCTGATGTGGGAGGAGGG - Intronic
966930071 3:184670677-184670699 GCTGAGGTACCCTGGGATGAAGG + Intronic
966930102 3:184670797-184670819 GCTGAGGTACCCTGGGATGAAGG + Intronic
966930143 3:184670954-184670976 GCTGAGGTACCCTGGGATGAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967809276 3:193743111-193743133 GCTGAGCTGACCTGGAAGTAAGG - Intergenic
968288574 3:197522214-197522236 GCAGAGCAGCACAGGAAGGAGGG - Intronic
968657881 4:1786468-1786490 GCTGAGCTGGAGTGGCAGGAGGG + Intergenic
968704478 4:2071629-2071651 GCTGGGCTGGCCTGGGAGGACGG + Intergenic
969505812 4:7587059-7587081 GCGGGGCTGCCCTGGGAGGTAGG + Intronic
972640514 4:40920906-40920928 GCTGACCTACACTGAGAGGAAGG + Intronic
974548952 4:63348629-63348651 GCAGAGCTGGGCTGGGGGGATGG + Intergenic
975622090 4:76306313-76306335 GCTGAGCTTCCCTGGGGAGAAGG + Intronic
975654992 4:76632577-76632599 GCTGAACTGCAGTGGGTTGAAGG + Intronic
978594746 4:110365081-110365103 GCAGAGCTGCTCTGAGAGGCTGG - Intergenic
982086507 4:151841618-151841640 GCTGGGCTGCAGTGGGGAGAGGG - Intergenic
982984217 4:162184859-162184881 ACTGAGATGCACTGGGAAGTGGG + Intergenic
983856137 4:172647680-172647702 GCAGAGCTGTGGTGGGAGGAGGG - Intronic
984823719 4:183906257-183906279 GCTGAGCTGCCCGGCGCGGAGGG + Exonic
984983466 4:185304726-185304748 GCAGGGCTGAAGTGGGAGGATGG - Intronic
985638949 5:1054223-1054245 GCAGAGCTGCGTTGTGAGGACGG - Intronic
986514908 5:8551218-8551240 GCTGAGCTCCAGTGTGAGCATGG - Intergenic
986641436 5:9875687-9875709 GCTGCGCTCGAATGGGAGGAGGG + Intergenic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
986986563 5:13506939-13506961 GCAGATTTGCACAGGGAGGAGGG + Intergenic
987933594 5:24434336-24434358 GCTCAGCTGAAGTGGGCGGATGG + Intergenic
988496895 5:31752960-31752982 GCTGTGCTGGCCTTGGAGGAGGG - Intronic
989128596 5:38081184-38081206 ACTGAGCTGGACTGAAAGGAAGG + Intergenic
990700346 5:58468113-58468135 GCTGAGCTGCAATGACAAGAAGG + Intergenic
991081617 5:62607051-62607073 ACAGTGCTGCACTGTGAGGATGG + Intronic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
997092215 5:130871220-130871242 GCTGTGCTGAACTGGGGGTAGGG - Intergenic
997234095 5:132262770-132262792 GGTGGGCTGGGCTGGGAGGATGG + Intronic
997428405 5:133820179-133820201 GCTGTGCTGCTCTGTGGGGAAGG - Intergenic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
998130238 5:139648199-139648221 CCCGAGCTGCGCTGGGAGGGAGG + Intronic
998797988 5:145839186-145839208 ACTGAGCTGCAGGGGCAGGAAGG - Intergenic
1001848010 5:174938584-174938606 GCACAGCTGCACATGGAGGAAGG - Intergenic
1001902294 5:175442614-175442636 GCTGAGCTGCACTGGGATGAAGG + Exonic
1002086038 5:176776235-176776257 CCTGGGCTGCGCTGGGAGGGCGG + Intergenic
1002211182 5:177600235-177600257 GCGCAGCTGCCCTGGGAGGACGG + Exonic
1003097122 6:3151128-3151150 ACTAAGCTGGACTGGGAGGCAGG - Intronic
1003793082 6:9568386-9568408 GGGGCGCTGAACTGGGAGGATGG + Intergenic
1004017109 6:11742210-11742232 GCTGAGATGCTCTGAGATGAGGG - Intronic
1007029481 6:38615152-38615174 CCTGAGTTGCACTTGGATGATGG - Intronic
1007253150 6:40510143-40510165 ACTGTGCTGCACAGGTAGGAGGG + Intronic
1007711265 6:43825815-43825837 GCTGAGCTGGGCTGGGCTGAGGG + Intergenic
1008936670 6:56999644-56999666 GCTTAGCTGCAGGGGAAGGAGGG - Intronic
1011410622 6:87062429-87062451 GGAAAGCTGCAGTGGGAGGATGG - Intergenic
1012142680 6:95643165-95643187 GGTGTGCTGCACTGGGGAGAGGG - Intergenic
1012278516 6:97301486-97301508 CCTGAGCGGCAGTGGAAGGAGGG - Intergenic
1013648682 6:112171373-112171395 GGTGAGCTGCTCTGGCAGGGTGG + Intronic
1015541320 6:134317179-134317201 GAAGAGTTGCATTGGGAGGAGGG - Intronic
1015962568 6:138665537-138665559 GCTGAGCAGCACTGTGAGTCAGG - Intronic
1017311740 6:152983538-152983560 GCTAAGCTGGACTGGGGGGAGGG - Intronic
1017991662 6:159494556-159494578 GCTGAGCTGTGTTGGGAGGAAGG - Intergenic
1018287687 6:162258101-162258123 GATGAGCTAAACTGTGAGGAGGG - Intronic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018669131 6:166165596-166165618 GCTAACCCGCACTGAGAGGAAGG - Intronic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1018904410 6:168066778-168066800 GTAGTGCTGCACTCGGAGGAAGG + Exonic
1019419799 7:945734-945756 GCAGAGCGGGGCTGGGAGGAGGG - Intronic
1019443861 7:1060935-1060957 GCTGGGCTGCAGGGGTAGGAGGG - Intronic
1019885340 7:3899620-3899642 GCTGAGCAGGCCTGGGAGGGAGG - Intronic
1023844972 7:44115472-44115494 ACTGGCCTGCAATGGGAGGAGGG - Intronic
1023874484 7:44279368-44279390 GCTGTGCAGCCCTGGGCGGAGGG + Intronic
1024051675 7:45627702-45627724 GCTGAGTTGGGCTGGGAGCAGGG + Intronic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1026209833 7:68294323-68294345 GCTTTGCTGCACTGGGTGGGTGG - Intergenic
1026477486 7:70749346-70749368 GCTGGGCGGCACGGGGAGGGGGG + Intronic
1026888663 7:73969444-73969466 GCTGAGCAGGGCTGGGAGGGAGG + Intergenic
1028773195 7:94650739-94650761 GTTGAGCTGCAATGTTAGGAAGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029679293 7:102096986-102097008 CCGGAGCTGCACGTGGAGGACGG - Intronic
1030085976 7:105816076-105816098 GTATAGCTGTACTGGGAGGATGG + Intronic
1032094100 7:128929082-128929104 GCTGAGCATCACTGGGATGAGGG - Intergenic
1032387365 7:131534021-131534043 GCTGAGCTGTGCAGGGGGGAAGG + Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1033521125 7:142161180-142161202 GGGGAGCTGTACTGGGATGACGG + Intronic
1034420859 7:150989905-150989927 GCTGAGGGTCACAGGGAGGATGG - Intergenic
1034470491 7:151251988-151252010 GCTGACCTTCACCGGGAGGGAGG - Intronic
1034509682 7:151523532-151523554 CCTGAATTTCACTGGGAGGAAGG + Intergenic
1035603385 8:912622-912644 GCTCAGCTCCACAGAGAGGAAGG - Intergenic
1035698668 8:1621289-1621311 GGTCAGCTGCACTGGGACCAGGG + Intronic
1036472948 8:9066883-9066905 GCTGAGCTGCAGTGGAGTGAGGG + Intronic
1037214806 8:16436536-16436558 GCTGAGTTACACTGAGAGAAAGG - Intronic
1038702595 8:29863006-29863028 GCTTTGCTGCACTGGGTGGGTGG - Intergenic
1039593492 8:38770133-38770155 CCTGCGCTGCTCTGTGAGGAAGG - Intronic
1040996262 8:53405943-53405965 GCAGAACTTCAGTGGGAGGAGGG - Intergenic
1041829073 8:62132424-62132446 GCTGAGCTGCAGTTAGAGGATGG + Intergenic
1043285999 8:78532365-78532387 GGTGAGCTGGAGTGGGATGAGGG - Intronic
1043864028 8:85355060-85355082 GCTGGGCTGAGCTGGCAGGAAGG - Intronic
1045732920 8:105263127-105263149 GGTGTGCTGCATTGTGAGGAGGG + Intronic
1047310816 8:123690344-123690366 GCAGAGCTGTGCTGGGAGGCGGG + Intronic
1047425448 8:124741376-124741398 GCTGTGATGCACTGGGGAGATGG - Intergenic
1047446158 8:124921564-124921586 GGTCAGCTGCACTGAGAGGCAGG + Intergenic
1047625627 8:126653163-126653185 GCCCAGCTGCACCTGGAGGATGG - Intergenic
1049551202 8:143260774-143260796 GCTGAGTGGGGCTGGGAGGATGG - Intronic
1049777772 8:144414348-144414370 GCTGACCTGCACTGGCTGCAGGG - Exonic
1049782484 8:144435295-144435317 GCTGGGCTGCAGGGAGAGGAGGG - Intronic
1051116367 9:13698388-13698410 GCTGAGCTGAAGGGGGAAGAAGG - Intergenic
1051163732 9:14238220-14238242 GCTCAGCTGTACTGGAGGGATGG + Intronic
1054805564 9:69393365-69393387 GCTGAGCTGCGGTGGGAAGGGGG + Intergenic
1056365148 9:85897418-85897440 GCTGGGCTGCAGTCTGAGGAGGG - Intergenic
1056776568 9:89517184-89517206 GGGAAGCTGCAGTGGGAGGATGG - Intergenic
1057209035 9:93189632-93189654 GCTGGGCTGTCCTTGGAGGATGG - Intronic
1057364920 9:94410690-94410712 GCTCAGCTTCATTGGGAGTAAGG + Intronic
1057658410 9:96977401-96977423 GCTCAGCTTCATTGGGAGTAAGG - Intronic
1057928217 9:99171182-99171204 GCTGAGCCCCAGGGGGAGGAAGG - Intergenic
1057955431 9:99403472-99403494 GATGAGATCCACTGTGAGGAGGG + Intergenic
1057964196 9:99487599-99487621 GCTGACCGGCACAGGGTGGAAGG - Intergenic
1058449500 9:105082943-105082965 CCTGAATTCCACTGGGAGGAAGG + Intergenic
1058968195 9:110056235-110056257 AGTCAGCTGCACTGGGAGGCGGG - Intronic
1059719108 9:116942250-116942272 GGTTAGCTGCAGTTGGAGGAGGG - Intronic
1060551029 9:124485521-124485543 CCTGGGCTGGGCTGGGAGGATGG - Intronic
1062390848 9:136333298-136333320 GCTGCGCTGCCCTGGGTGGAGGG - Intronic
1062504011 9:136863654-136863676 CCAGAGCTGCTCTGGGAAGATGG + Intronic
1062528377 9:136987877-136987899 ACTGAGTGGCACTGGGAGAAGGG - Intergenic
1186757202 X:12684555-12684577 GCTGTGCTGCCCTGTGAGCATGG + Intronic
1186947102 X:14580756-14580778 GCTGAGATGCTCTGGGCAGAAGG - Intronic
1190502848 X:51096650-51096672 CCTGAGCTGCCCTGGCAGGTCGG - Intergenic
1191662528 X:63665966-63665988 GCTGATCTACACTGGGGAGATGG - Exonic
1193312059 X:80021909-80021931 GCACATGTGCACTGGGAGGAAGG + Intronic
1194754542 X:97722983-97723005 GCAGGGCTGCAGTGGGAGGTAGG - Intergenic
1194953519 X:100153629-100153651 GGTGTTCTGCACTGGGAGCAGGG + Intergenic
1195010447 X:100728641-100728663 GGGGGACTGCACTGGGAGGAAGG - Intronic
1198412693 X:136387658-136387680 GCTGAGCTGGGGTGGGAGGTGGG + Intronic