ID: 966504464

View in Genome Browser
Species Human (GRCh38)
Location 3:180684017-180684039
Sequence CAGTGGAGATGGAGAGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 5, 2: 24, 3: 95, 4: 710}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966504464_966504467 -5 Left 966504464 3:180684017-180684039 CCTACTGCTCTCCATCTCCACTG 0: 1
1: 5
2: 24
3: 95
4: 710
Right 966504467 3:180684035-180684057 CACTGCCACTACTCTAATTTAGG 0: 1
1: 0
2: 5
3: 24
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966504464 Original CRISPR CAGTGGAGATGGAGAGCAGT AGG (reversed) Intronic
900279996 1:1860790-1860812 AAGTGGAGGGGCAGAGCAGTAGG - Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902070982 1:13737415-13737437 CAGTGGTGATGGAGACCATATGG + Intronic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903348930 1:22706477-22706499 CAGTGGGGAGGGATAGCATTAGG + Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903930408 1:26858846-26858868 CAGTGGAGGTAGAGAGCAAATGG + Intergenic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905829127 1:41050134-41050156 CAGTGGGGAAGGGGTGCAGTGGG + Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906856576 1:49312832-49312854 CAGTGAAGATGCGGAGCAATAGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907994577 1:59616492-59616514 GAGTGGAGAGGGATAGCATTAGG + Intronic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908677093 1:66617334-66617356 CAGTTAAGATGGAGGCCAGTTGG - Intronic
908690926 1:66779633-66779655 CAGAGGAGAGAGAGAGCAGGAGG - Intergenic
908693355 1:66807928-66807950 TAGAGGGGATAGAGAGCAGTGGG - Intergenic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908982621 1:69977048-69977070 CAATGGAGATGCAGAGTATTGGG - Intronic
909132490 1:71755260-71755282 CAGTGGAGGTGAAGAGGACTCGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909465317 1:75967295-75967317 TCGTGGTAATGGAGAGCAGTGGG - Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
909914235 1:81298052-81298074 CAGAGAAGATGGAGAGGACTGGG + Intergenic
910313584 1:85856679-85856701 CAGTGGAGGTGGGGAAGAGTAGG - Intronic
910324655 1:85992052-85992074 GAGTGGAGAGGGATAGCATTAGG - Intronic
910414988 1:86988057-86988079 CAGTGGGGATGAAGATCTGTGGG + Intronic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
912117666 1:106426651-106426673 GAGTGGAGAGGGATAGCATTAGG + Intergenic
912178568 1:107190556-107190578 GAGTGGAGAGGGATAGCATTAGG - Intronic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913231093 1:116741321-116741343 GAGTGGACATGGAGGGCATTTGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
915339125 1:155166817-155166839 CAGAGAAAAGGGAGAGCAGTAGG - Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915594588 1:156888812-156888834 CAGTGGAGGTGCTGAGGAGTGGG - Intergenic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
917089509 1:171338478-171338500 TGGATGAGATGGAGAGCAGTAGG - Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918418987 1:184342832-184342854 CAACAGAGATGGAGGGCAGTGGG - Intergenic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
918722665 1:187873776-187873798 CAGTGGGGAAGGATAGCATTAGG - Intergenic
918946876 1:191077883-191077905 CAGTGGGGAGGGATAGCATTAGG - Intergenic
919158879 1:193803050-193803072 GAATTGAGATGGAGAGGAGTTGG + Intergenic
919474313 1:198016150-198016172 CACTGGAGAGGGAGACCATTAGG - Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919888880 1:201955594-201955616 CAAGGGAGAAGGAGGGCAGTGGG - Intronic
919934652 1:202243577-202243599 CAGGGGAGGTGTAGAGCAGGAGG + Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922550855 1:226493331-226493353 CCATGGAGAGGGACAGCAGTTGG + Intergenic
922591882 1:226783606-226783628 CACTGAGGATGGAGAACAGTGGG + Intergenic
923271258 1:232357172-232357194 CAGTGGAGGTGGTGAGGCGTGGG + Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
1063972474 10:11390853-11390875 CAATGGAGATAGAGAGTAGAAGG + Intergenic
1064139699 10:12780073-12780095 AAAAGGAGATGGAGAACAGTTGG + Intronic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064508478 10:16062921-16062943 CAGTGGGGGTGGATAGCATTAGG - Intergenic
1064511414 10:16097113-16097135 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1064847918 10:19676809-19676831 CAGGGGAGAGGGAGAGCATCAGG - Intronic
1064969615 10:21051375-21051397 GAGTAGAGATGTAAAGCAGTAGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1065967506 10:30781611-30781633 CAGTGGCAATGGGGACCAGTGGG - Intergenic
1066367763 10:34793277-34793299 CAAGGGAGCTGGAGGGCAGTAGG + Intronic
1066426165 10:35309400-35309422 AGGTGGAGAGGAAGAGCAGTGGG + Intronic
1067786621 10:49254982-49255004 CGGTGCAGGTGGAGGGCAGTGGG - Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068434354 10:56971488-56971510 CAAAGGAGATGGAGAACAGCTGG - Intergenic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069919859 10:71810025-71810047 CAGTGATGTTGGAGAGCAGGTGG - Exonic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070109193 10:73466077-73466099 AAGTGAAGATGGAGAACAGTAGG - Intronic
1070311342 10:75276053-75276075 CAGTGGAGAAGCAGAGCGGGGGG + Intergenic
1070460345 10:76661181-76661203 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1071857273 10:89638417-89638439 CAGTTGATAAGGAGATCAGTAGG - Intronic
1072252037 10:93589335-93589357 GAGTGAAAATGGAGACCAGTTGG + Exonic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1074260909 10:111852235-111852257 CAGTGGAGCAGGAGAGCCCTGGG - Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074929738 10:118112198-118112220 CAGATGGGATGGAGACCAGTTGG + Intergenic
1075006700 10:118835841-118835863 GAGAGGAGATGGATGGCAGTGGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075719146 10:124574865-124574887 GAGTGGAGAAGGACAGCAGTGGG - Intronic
1075844380 10:125533849-125533871 CCGTGTAGCTGCAGAGCAGTCGG + Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077827830 11:5830100-5830122 CAGTGGGGAGGGATAGCATTAGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078442594 11:11379675-11379697 CGATGGAGATGGAGACCAATAGG - Intronic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1078893101 11:15575135-15575157 CAGAGGAGATAGAGTGCTGTAGG + Intergenic
1079232868 11:18664767-18664789 GAGGGGAGAGGGATAGCAGTAGG + Intergenic
1079765298 11:24384814-24384836 AAATGCAGATGGGGAGCAGTTGG - Intergenic
1080514431 11:33006899-33006921 AAGTGGAGATGTAGTGGAGTTGG + Intergenic
1080903271 11:36515630-36515652 CAGTGGAGGGGCAGGGCAGTGGG + Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081206720 11:40284108-40284130 CAGAGGACAGGGAGATCAGTGGG + Intronic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081329445 11:41786447-41786469 CCAAAGAGATGGAGAGCAGTAGG - Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1082669986 11:56023777-56023799 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084472795 11:69373020-69373042 CAGGGGAGAGGGTGGGCAGTGGG + Intergenic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1084951333 11:72667501-72667523 CAATGGAGGTGGAGAACAATGGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085553745 11:77400487-77400509 CAGTGCAGATGGGTAGCAGATGG - Intronic
1085731372 11:79001969-79001991 CAGGGGAGATGGGGAGCTATGGG - Intronic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086546053 11:87968882-87968904 CACTGGAGATTCAGAACAGTAGG + Intergenic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1087876270 11:103361686-103361708 CAGAGCAGATGAAGAGCAGTGGG + Intronic
1088936313 11:114404015-114404037 GAATGAAAATGGAGAGCAGTAGG + Intronic
1089082754 11:115790850-115790872 AAGGGGAAATGGAGAGCATTGGG + Intergenic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1091041937 11:132289479-132289501 CATGGGAGCTGGAGAGCAGGGGG - Intronic
1091340352 11:134807405-134807427 CACTGGAGATAGAGAGGAGGAGG + Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091682504 12:2537130-2537152 AAGTGGAGGAGGAGGGCAGTGGG - Intronic
1091828490 12:3532968-3532990 GGGTGGAGACTGAGAGCAGTGGG + Intronic
1091862308 12:3796921-3796943 CAAAGAAGATGGAGAGCAGCTGG + Intronic
1092087783 12:5777971-5777993 CAGAGGAGATGGGGAACAGCTGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092550491 12:9494137-9494159 CAGTGGGGAGGGATAGCATTAGG - Intergenic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094492882 12:30972208-30972230 GAGTGGAGCTGGAGGTCAGTGGG + Intronic
1094521325 12:31192231-31192253 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095577529 12:43757854-43757876 CAGTCCAGATACAGAGCAGTGGG + Intronic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096571959 12:52528693-52528715 GGGTAGAGATGGAGAGCATTTGG - Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097177368 12:57151236-57151258 GAGTGCAGATGCTGAGCAGTGGG + Intronic
1097599490 12:61673112-61673134 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1097611830 12:61832646-61832668 CACTGGATATGGCCAGCAGTAGG - Intronic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1098233765 12:68398647-68398669 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098774228 12:74590832-74590854 CAGTGGAGAATTGGAGCAGTAGG - Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099136965 12:78917472-78917494 GAGTGGAGAGGGATAGCATTAGG + Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099571139 12:84320475-84320497 GAGGGGAGATGGATAGCATTAGG - Intergenic
1100088324 12:90938366-90938388 AAGTGGAGTTGAAGAGCAATGGG + Intronic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1103627960 12:122234957-122234979 GAGTGGAGAGGCAGTGCAGTGGG - Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105592141 13:21802262-21802284 GAGTGCAGATGGATGGCAGTAGG + Intergenic
1105605447 13:21922957-21922979 CAGTGGAGATGGACAAGTGTCGG + Intergenic
1105805414 13:23949274-23949296 CCTTGGAGAGGAAGAGCAGTTGG - Intergenic
1106481400 13:30139913-30139935 CAGTTGAGAGGGAGAGCGGCCGG - Intergenic
1106841389 13:33688316-33688338 CAAAGGAGGTGGAGAGCTGTGGG + Intergenic
1107233298 13:38137582-38137604 GAGTGGGGATGGATAGCATTAGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1112863762 13:103868493-103868515 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1113928730 13:113955080-113955102 CAGTGGGGATGAGGAGCAGCTGG + Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114637501 14:24195978-24196000 CCGGGGAGATGGAGCGCAGGCGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116170590 14:41396499-41396521 CAGGGGAGAGGGATAGCATTAGG + Intergenic
1116339632 14:43704517-43704539 GAGTGGGGAGGGATAGCAGTGGG + Intergenic
1116619268 14:47177661-47177683 CAGTGGGGAGGGATAGCAGTAGG + Intronic
1116874780 14:50100119-50100141 CAGTGGGGAGGGAGAGCATCAGG - Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117201917 14:53399053-53399075 CAGTGGAGATGGGGTGGGGTGGG + Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119182128 14:72612346-72612368 CAGAGGAGGTGGGGAGCAGGTGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119599340 14:75964544-75964566 CAGTGAGGATGGACAACAGTTGG - Intronic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1120649976 14:87120242-87120264 GAGTGGAGAGGGATAGCATTAGG + Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1121937963 14:98037776-98037798 CTGCCGAGATGGAGGGCAGTGGG - Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122198275 14:100106088-100106110 AAGTGGAAACGGAGAGCTGTTGG + Intronic
1122246724 14:100408276-100408298 CAGTGAAGGAGGGGAGCAGTGGG - Intronic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1122896030 14:104757497-104757519 CATTGGAGACGGAGAGCCCTGGG + Intronic
1123067188 14:105624665-105624687 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123071207 14:105643392-105643414 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123076169 14:105668435-105668457 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123090867 14:105741662-105741684 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123096503 14:105769426-105769448 CCGTGGAGTGGGAGAGCAGCGGG - Intergenic
1123159765 14:106267070-106267092 TAGTGGGGAGGGAGAGCATTAGG + Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126575577 15:50193159-50193181 CGGTGGAGATGAAGATCAGCTGG - Intronic
1126695440 15:51321763-51321785 CAGAGCAGATGGACAGCACTAGG + Intronic
1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG + Intergenic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128234719 15:66059668-66059690 GAGTGGAGAGGGTGAGCAGAGGG + Intronic
1128541476 15:68537629-68537651 CGGTGGGGAGGGAGAGCATTGGG - Intergenic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130303953 15:82700355-82700377 CAGTGGCATTGGAGACCAGTGGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131818125 15:96244119-96244141 TATTGGATATGGACAGCAGTGGG + Intergenic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1133489112 16:6249905-6249927 GAGTGGGGAGGGACAGCAGTTGG - Intronic
1133876920 16:9743735-9743757 TAGTGGAAATGAAGAGCAGCAGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134017051 16:10895931-10895953 GAGGGGAGATGGAGGCCAGTGGG + Intronic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1136087300 16:27894701-27894723 CAGAGGCCATGGAGAGCTGTAGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1137525667 16:49234087-49234109 GAGGGGAGAGGGAGAGCATTAGG + Intergenic
1137528604 16:49261401-49261423 GAAAGGAGGTGGAGAGCAGTTGG - Intergenic
1137543631 16:49382275-49382297 GAGTGGAGAGGGATAGCATTAGG + Intronic
1137878451 16:52020533-52020555 GAGTGGAGAGGGATAGCATTAGG + Intronic
1138256012 16:55561541-55561563 CCGTGAAGATGGAGGGCATTTGG - Intronic
1138540303 16:57683824-57683846 CAGTGGGGGTGGAGAGCCATAGG + Intronic
1139380389 16:66527023-66527045 CAGAGGAGAGCGAGAGCAGAAGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141074776 16:80994697-80994719 CAGTGGTGATGGACAGTGGTAGG + Intronic
1141345274 16:83239224-83239246 CACTGCAGAGGGAGAGCAGCAGG + Intronic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144628751 17:16858877-16858899 CAGAGGAGATGCAGTGCAGAGGG - Intergenic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1145160325 17:20569450-20569472 CAGAGGAGATGCAGTGCAGAGGG - Intergenic
1145916721 17:28578335-28578357 CAGAGGAGCTGGACAGCAGGTGG - Intronic
1146421582 17:32691317-32691339 TAGTGGAGATGAAGAGCGATTGG - Intronic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1146949314 17:36894697-36894719 CAGTGGTGATGGAGAGTGTTGGG - Intergenic
1146949988 17:36899345-36899367 CTGTGGAGATGGAATTCAGTAGG + Intergenic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147527209 17:41237440-41237462 CAGAGCAGATCGAGAGCAGGGGG - Intronic
1147528333 17:41249110-41249132 CAGAGCAGATCGAGAGCAGGTGG - Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147853728 17:43462470-43462492 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149106703 17:52976033-52976055 CAGTGAAGATGTGGAGCAGTAGG - Intergenic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1151060615 17:71089225-71089247 CATTGGAATTGAAGAGCAGTTGG + Intergenic
1151407998 17:73902036-73902058 CAGTGGAGATGGGGGGCGGGGGG - Intergenic
1152170023 17:78739723-78739745 CACAGGAGCTGGAGACCAGTTGG + Intronic
1152494870 17:80663951-80663973 CGGGGAAGATGCAGAGCAGTGGG - Intronic
1152669476 17:81593821-81593843 CAGGGTAGCTGGAGAGCAGCTGG - Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1155078041 18:22380270-22380292 CAGTGGTGATGGAGCGGGGTGGG + Intergenic
1155340620 18:24810915-24810937 CAGTGGAGCAAGAGAGCATTTGG - Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157132932 18:45024507-45024529 CAGTGAAGATGAAGAGCCCTCGG - Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160381727 18:78462474-78462496 CAGAGGGGAAGGAGAGCATTAGG - Intergenic
1160479748 18:79227702-79227724 CAGTGAGGAAGGAGAACAGTCGG - Intronic
1160970349 19:1765160-1765182 TAGAGGAGATGGAGACCAGCTGG - Intronic
1161783593 19:6309800-6309822 CAGTGGTGATGAAGACCAGGCGG + Exonic
1161848440 19:6725730-6725752 CTGGGAAAATGGAGAGCAGTGGG + Intronic
1162080458 19:8214874-8214896 CAGAGGAGATGAAGGGCAGTGGG + Intronic
1162649411 19:12075065-12075087 CAGTGGGGAGGGATAGCATTAGG + Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163357751 19:16825381-16825403 CAGTGGAAGTAGAGAGCGGTGGG - Intergenic
1164423235 19:28116332-28116354 GAGGGGAGATGGATAGCATTAGG - Intergenic
1164850349 19:31478130-31478152 CAGAGGAGAGAGAGAGCATTGGG - Intergenic
1165407732 19:35641375-35641397 GTCTGGAGAAGGAGAGCAGTGGG + Intergenic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166521484 19:43483314-43483336 CACTGAAGCTGGAGTGCAGTGGG + Intronic
1166549352 19:43654873-43654895 CAGTGGAGCAGGGGAGGAGTGGG + Intronic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166879737 19:45920492-45920514 CAGGGGAGATGAAGACCAGGGGG + Intergenic
1168103585 19:54153680-54153702 CAGTGGAGAGGGGGATCAGGGGG - Intronic
1168165467 19:54544207-54544229 CAGGGGGTATGGAGAGCATTAGG - Intronic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
926075004 2:9935435-9935457 AAGGGGAGAGGGAGAGCAGATGG + Intergenic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
927366983 2:22307960-22307982 GAGTGGGGATGGATAGCATTAGG + Intergenic
927884536 2:26710393-26710415 GGGTGCAGATGAAGAGCAGTGGG + Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928765581 2:34641327-34641349 CAGTGGGGAGGGATAGCATTAGG + Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928916841 2:36481251-36481273 GAGTGGAGAAGGAAGGCAGTTGG + Intronic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929922476 2:46182408-46182430 CACTGGAGAGGGAGAACAGATGG + Intronic
930043586 2:47148660-47148682 GAGTGGAGAGGGATAGCATTAGG - Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931777650 2:65554163-65554185 CAGTTGAGGTGGAGAGTGGTAGG + Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931995664 2:67837026-67837048 CAGAGCAGCTGGAGAGCACTGGG + Intergenic
932111485 2:69005442-69005464 CAGGGGGGAAGGATAGCAGTGGG + Intergenic
932207142 2:69893214-69893236 CTGGGGAGAGGGAGAGCATTGGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932733446 2:74236852-74236874 TGTTGGAGATGGAAAGCAGTAGG - Intronic
932948800 2:76269139-76269161 GAGAGGAGATGGAGACCAGCTGG - Intergenic
933674092 2:85037839-85037861 CAGAGCAGAAGGTGAGCAGTGGG + Intronic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
934936425 2:98469167-98469189 CAGCTGGGGTGGAGAGCAGTGGG + Intronic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936673688 2:114689208-114689230 CATGGGAGAGGGAGAGCATTAGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936908740 2:117568189-117568211 CAGTGGGGAGGGATAGCATTAGG + Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937668078 2:124509673-124509695 CAATGAATATGGAGAGCAGCAGG - Intronic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938664896 2:133524623-133524645 AGGTGCACATGGAGAGCAGTGGG - Intronic
939167141 2:138652145-138652167 TAGTGGAGAGGGAGAGGTGTGGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940864768 2:158807105-158807127 CACTGGAGAAGGTGAGCCGTGGG + Exonic
940906284 2:159172877-159172899 CGGTGGAGCTGGAGAGCTGCTGG + Intronic
941885324 2:170521785-170521807 CAGTGGACCTGGACAGCAGTTGG - Intronic
942376608 2:175344005-175344027 AGGTGGAGATGCAGAGCTGTTGG + Intergenic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
943766928 2:191673059-191673081 GAGTGGGGAGGGATAGCAGTAGG + Intergenic
943975842 2:194475464-194475486 GAGTGGGGATGGATAGCATTAGG + Intergenic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944623440 2:201543988-201544010 CAGTGGGGAGGGATAGCATTAGG - Intronic
944877058 2:203972939-203972961 GAGTGGAGTTGGAGAAGAGTGGG - Intergenic
945714746 2:213344509-213344531 AAGTGGAGAGGGATAGCATTAGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946704910 2:222448926-222448948 CACTGGAGATGGGGAACAGCTGG - Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
947040429 2:225912174-225912196 GAGTGGGAATGGACAGCAGTGGG - Intergenic
947120979 2:226814571-226814593 CAAAGGAGATGGAGAGCATGAGG + Intergenic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169602546 20:7278001-7278023 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169742625 20:8911747-8911769 CAGTAAAGATGTAGAGCAATTGG + Intronic
1170246893 20:14231268-14231290 CAGTGGGGAGGGATAGCATTAGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1172137591 20:32697661-32697683 CAGTGGAGATGGAGCACTGGAGG + Intergenic
1172285086 20:33734552-33734574 GAGTGGGGAGGGGGAGCAGTGGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172848902 20:37946452-37946474 CAGGGGAGGGGGAGAACAGTGGG - Intergenic
1173046792 20:39520461-39520483 CAGTGGACATACAGAGTAGTGGG + Intergenic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173522569 20:43710674-43710696 CAGTGGAGAGAGACAGCAGGGGG - Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174683797 20:52434194-52434216 CTGTGTAGAAAGAGAGCAGTTGG + Intergenic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1176199392 20:63853745-63853767 GAGTGGAGACGGGGAGCAGGAGG - Intergenic
1176289783 21:5037854-5037876 CAGTGGAGAGGGAAGACAGTGGG - Intronic
1176348881 21:5774207-5774229 CAGTGCACATTGGGAGCAGTGGG + Intergenic
1176355695 21:5894791-5894813 CAGTGCACATTGGGAGCAGTGGG + Intergenic
1176543202 21:8172277-8172299 CAGTGCACATTGGGAGCAGTGGG + Intergenic
1176562153 21:8355322-8355344 CAGTGCACATTGGGAGCAGTGGG + Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1178809863 21:35871808-35871830 CAGTGCAGATGGACAAGAGTCGG - Intronic
1179867447 21:44225733-44225755 CAGTGGAGAGGGAAGACAGTGGG + Intronic
1180845100 22:18976470-18976492 CAGGAGAGATGCAGAGCACTAGG - Intergenic
1181681701 22:24499946-24499968 CAAGGGAGCTGGCGAGCAGTGGG - Intronic
1181933146 22:26418954-26418976 CACTGGAGCTGGAGAGCAAGAGG + Intergenic
1181977129 22:26738007-26738029 CGGTGCAGAGGGAGACCAGTCGG + Intergenic
1182226284 22:28800959-28800981 AAGTCGAGATAGAGCGCAGTTGG + Intergenic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183791341 22:40072899-40072921 CAGTGGAGGTATAGAGCATTGGG + Intronic
1184921846 22:47610639-47610661 CAGTCGTGAGGGGGAGCAGTTGG - Intergenic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
1185338781 22:50282559-50282581 AAGTGGATCTGGAGTGCAGTGGG + Intronic
1203248073 22_KI270733v1_random:88515-88537 CAGTGCACATTGGGAGCAGTGGG + Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950072313 3:10162650-10162672 CAGTGGTGATGGAGAGCCTGGGG + Intergenic
950119772 3:10474097-10474119 CAGTGGTGTTGGAGAGGTGTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
952254534 3:31684018-31684040 CAGCGGTGATGGCCAGCAGTAGG + Exonic
952433668 3:33250091-33250113 CCATGGAGATAGAGAGCAGAAGG - Intergenic
952713580 3:36455555-36455577 CAAAGAAGATGGAGACCAGTTGG + Intronic
952785150 3:37146462-37146484 CTGTGGAGAGGGAGCACAGTGGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953085572 3:39663266-39663288 CAGGGCAGAGGGAGAGCATTTGG + Intergenic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
954163426 3:48738253-48738275 TAGTGGAGATGTCAAGCAGTGGG + Intronic
954444577 3:50539856-50539878 CAGTGGAGATGGGTAGGTGTGGG - Intergenic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
954984741 3:54779696-54779718 CAGTAGAGAAGCAGAGCAGCAGG - Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
957977122 3:87460859-87460881 CAGTGGACTTAAAGAGCAGTGGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959909918 3:111752778-111752800 CAGTGGGGAGGGATAGCATTAGG - Intronic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960702198 3:120450323-120450345 CAGAGGAGACTGAGAGTAGTTGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960970423 3:123135379-123135401 CAGGGGAGAGGAAGAGCAGGGGG - Intronic
961168013 3:124776973-124776995 CAGGGGAAATGAAGAGCAGCAGG - Intronic
961350761 3:126300513-126300535 CAGGGGAGATGGGGAGCCATGGG - Intergenic
961487026 3:127223692-127223714 GACTGGAGAGGGAGAGCAGGGGG + Intergenic
961500182 3:127326818-127326840 CAGTTGAGATGTATAGCAGGAGG - Intergenic
961634441 3:128323998-128324020 CAGAGCAGATGGAGGCCAGTGGG - Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962287740 3:134101945-134101967 AAGTGGTGATGGACAGCACTTGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963371583 3:144407815-144407837 CAGTAGAGATGAAGAACAGCTGG + Intergenic
963376634 3:144474896-144474918 GAGTCAAGATGGTGAGCAGTGGG - Intergenic
963384780 3:144577642-144577664 CAGTGAAGATGCACAGCAATTGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967992791 3:195144199-195144221 CACTCGAGATGGAGTGGAGTGGG - Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968647811 4:1749026-1749048 CGGTGGGGAGGGAGAGCGGTGGG - Intergenic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
972988128 4:44790811-44790833 CAGGGGAGATGAAGAGGGGTTGG - Intergenic
973290823 4:48468656-48468678 CCAAGGAGATGGAGAGCATTAGG - Intergenic
973816499 4:54624360-54624382 CAGTGGAGCTGGGGAACAGCTGG + Intergenic
973818996 4:54646009-54646031 CAGTGCAGTTGGAGAGCGCTGGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
974917863 4:68200053-68200075 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
974918147 4:68202944-68202966 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
974962642 4:68722679-68722701 CAGTGGGGAGGGATAGCATTAGG + Intergenic
975526391 4:75354894-75354916 GAGTGGAGAAGGATAGCATTAGG + Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976328991 4:83805985-83806007 CAGTGGGGAGGGATAGCATTGGG + Intergenic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977796507 4:101172062-101172084 AAGTACTGATGGAGAGCAGTGGG + Intronic
978039524 4:104041959-104041981 GAGTGGAGAGGGATAGCATTAGG + Intergenic
978055830 4:104264862-104264884 CATTGCAGTAGGAGAGCAGTGGG + Intergenic
978564450 4:110066896-110066918 CAATGGGGAGGGAGAGCATTAGG - Intronic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981216542 4:142176267-142176289 CAGTGGGGAGGGATAGCATTAGG - Intronic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982556018 4:156866086-156866108 CAGTGGAGAGGGATAGCCTTAGG - Intronic
982652027 4:158098356-158098378 GAGTGGAGAGGGATAGCATTAGG + Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
985242766 4:187948392-187948414 GAGAGGAGAGGGAGAGCATTAGG - Intergenic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986066948 5:4243708-4243730 CAGTGGCGGAGTAGAGCAGTAGG + Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
986991767 5:13561936-13561958 GAGTGGGGAGGGAGAGCATTAGG + Intergenic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987801395 5:22701329-22701351 CTGTGGAGTTGGAGAACATTAGG - Intronic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989125539 5:38049108-38049130 CAGGGGAGTGGGAGAGGAGTGGG + Intergenic
989238890 5:39180713-39180735 TAGCTAAGATGGAGAGCAGTAGG + Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989763262 5:45047344-45047366 CAGTGGGGAGGGATAGCATTAGG - Intergenic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990831663 5:59965815-59965837 TAGTGGAGATGGAGACCATTCGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992009321 5:72511019-72511041 TAGTGGAGATGGGGAGCCGCTGG - Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
994021054 5:95026477-95026499 CAATGGAGATAGAGAGTAGAAGG - Intronic
994146716 5:96403394-96403416 GAGTGGAGAGGGATAGCATTAGG - Intronic
994242652 5:97443431-97443453 CAGTGTAGATTGAGTACAGTCGG + Intergenic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995715953 5:115082120-115082142 CCCTGGAGATGGAGATCACTGGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997505196 5:134411647-134411669 CCATGGAGAGGGAGAGCAGCTGG + Exonic
997530805 5:134580069-134580091 CAGTGCAGGTGGAGGGCTGTAGG + Exonic
997609644 5:135206657-135206679 CAGTGGAGGAAGAGAGCAGCAGG - Intronic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
998145429 5:139725100-139725122 CACTGGAGATGGACTGCAGGAGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
1000080917 5:157846027-157846049 CAGAGGAGAGGGAGAGCGGCAGG - Intronic
1000200917 5:159010208-159010230 CAGATGAGATGGAGATGAGTAGG + Intronic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001388007 5:171355891-171355913 GAGGGGGGAGGGAGAGCAGTGGG - Intergenic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001838486 5:174852927-174852949 CAGTGGAGGGGGATGGCAGTGGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003634015 6:7814828-7814850 CAGGGGAGGGGGAGAGCATTAGG + Intronic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005954354 6:30653347-30653369 TACTGGAGATTGAGAGCAGTTGG - Exonic
1006050923 6:31343410-31343432 CAGTGGGGAGGGATAGCACTAGG + Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1008356898 6:50565663-50565685 CAGTGGCTATGGAGAGCCGGAGG - Intergenic
1009340646 6:62550710-62550732 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1009341455 6:62559587-62559609 GAGTGGAGAGGGATAGCATTAGG + Intergenic
1009418281 6:63439215-63439237 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1009863643 6:69368352-69368374 AAGTGGAGATAGAAAACAGTGGG + Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011967779 6:93181150-93181172 GAGTGGGGAGGGAGAGCATTAGG - Intergenic
1012893219 6:104920494-104920516 CACTGGAGGTGGGGTGCAGTGGG + Intergenic
1013941452 6:115667913-115667935 CAGCGTGGATGAAGAGCAGTTGG - Intergenic
1014091747 6:117411679-117411701 CAGTTCATATGGAGGGCAGTGGG - Intronic
1014137321 6:117905433-117905455 CAGAGGAGATGTAGAGCATTTGG + Intergenic
1014340326 6:120197530-120197552 GAGTGGAGATGGAAAGCACTAGG + Intergenic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015910524 6:138164159-138164181 CAGTGGAAATGGACTGGAGTGGG - Intronic
1016039835 6:139421501-139421523 GGGTGGAAAGGGAGAGCAGTAGG - Intergenic
1016567056 6:145467004-145467026 GAGTGGAGAGGGATAGCACTGGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019417242 7:933470-933492 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417253 7:933500-933522 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417269 7:933537-933559 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417300 7:933627-933649 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417311 7:933657-933679 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417322 7:933687-933709 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417353 7:933777-933799 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417394 7:933897-933919 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417415 7:933957-933979 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417426 7:933987-934009 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417465 7:934107-934129 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417486 7:934167-934189 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417497 7:934197-934219 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019796769 7:3055551-3055573 CACAGAAGATGGAGAGCACTGGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022483962 7:30763506-30763528 CAGGGGAGAGGGAGAGCAAGAGG + Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023398966 7:39777850-39777872 CAGTGAAGATGTGGAGGAGTTGG - Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024651475 7:51406840-51406862 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024898533 7:54289769-54289791 GAGGGGTGATGAAGAGCAGTTGG + Intergenic
1025133680 7:56392650-56392672 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1025479697 7:60966468-60966490 GAGTGGAGAGGGATAGCATTAGG + Intergenic
1025715211 7:63949856-63949878 CAGAGGAGAAGGTGAGCTGTGGG + Intergenic
1026968182 7:74453562-74453584 CAGTGGTGGTGGGGAGCGGTGGG + Intergenic
1028364213 7:90008371-90008393 AATTGGAGTTGGAGAGCAGCTGG - Intergenic
1028657653 7:93229111-93229133 CAATGTAGATGCAGAACAGTGGG + Intergenic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1029393182 7:100288820-100288842 CAGTGGGTATGGGGAGCCGTGGG + Intergenic
1029785569 7:102786689-102786711 CAGTGGGGAGGGATAGCATTAGG + Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031269792 7:119634168-119634190 GAGGGGAGATGGATAGCATTGGG - Intergenic
1031320668 7:120323428-120323450 GAGTGGGGAGGGATAGCAGTGGG - Intronic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032238137 7:130141714-130141736 TGGAGGAGAGGGAGAGCAGTGGG - Intergenic
1032411382 7:131695421-131695443 TGGTGGAGATGGACAGCAGCTGG + Intergenic
1032444276 7:131968144-131968166 CAGAGGAGAGGCAGAGCAGAAGG - Intergenic
1032668447 7:134061796-134061818 CAGGGGACATGCAGAGCTGTAGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1036408445 8:8476738-8476760 GAGTGGGGAGGGATAGCAGTGGG + Intergenic
1036561784 8:9904880-9904902 GAGTGGAGATGGAGGTGAGTAGG - Intergenic
1036757639 8:11481783-11481805 CAATGGAGATGGGGAAAAGTGGG + Intergenic
1037352191 8:17972346-17972368 AAGAGGAGGTGGAAAGCAGTAGG + Exonic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038046634 8:23771035-23771057 GATGGGAGATGGTGAGCAGTTGG + Intergenic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039983071 8:42425506-42425528 CCGTGTAGTTGGAGAGCAGATGG - Intronic
1040962455 8:53049027-53049049 AAGTGGAGATGGACAGCATCTGG - Intergenic
1041314705 8:56549160-56549182 GAGGGGAGAGGGAGAGCATTAGG - Intergenic
1041487187 8:58392189-58392211 CAGAGAAGATGGGGAGGAGTAGG - Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041771261 8:61474926-61474948 CAGTGGGGAGGGATAGCATTAGG - Intronic
1041772414 8:61485958-61485980 CAGTGGGGAGGGATAGCATTAGG + Intronic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG + Intergenic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1043183025 8:77108712-77108734 GAGGGGAGATGGATAGCATTAGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044963879 8:97556905-97556927 CGGTGTAGAGGGAGAGGAGTGGG + Intergenic
1044980509 8:97711611-97711633 AAGTGGAGGTGGGGAGCGGTGGG - Intronic
1045064685 8:98435012-98435034 CAGTCCAGGTGGAGAGCAGTGGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045791017 8:105984467-105984489 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1045816725 8:106285097-106285119 CAGTGGGGAGGGATAGCATTAGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046551878 8:115728428-115728450 CAGTAGAGATGGATTTCAGTGGG + Intronic
1046715341 8:117560941-117560963 CAGTGGGGAGGGATAGCATTAGG - Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047489917 8:125365920-125365942 CAGGCAAGAGGGAGAGCAGTTGG - Intronic
1047634485 8:126744996-126745018 CAGTGAAGATGAAGAAAAGTAGG + Intergenic
1047739230 8:127793992-127794014 CACTGGAGCTGGAGCTCAGTCGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1047984905 8:130222510-130222532 CAGTGGAGAAGGATAGGATTTGG - Intronic
1048008759 8:130440120-130440142 CAATGGAGGTAGAGAGAAGTGGG - Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048294969 8:133207285-133207307 CAGGGGAGAAGCAGGGCAGTGGG + Intronic
1049046885 8:140159422-140159444 CTAAGGAGTTGGAGAGCAGTGGG - Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051998992 9:23253207-23253229 CAGTGGGGAGGGAGAGCATCAGG + Intergenic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1052152274 9:25131603-25131625 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1052154899 9:25173534-25173556 CAGTGGAGGAAGAAAGCAGTGGG - Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053036623 9:34832084-34832106 CAGTGGAGATAAGGAGCAGATGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055028852 9:71751541-71751563 CAGTGAAAATTGAGAACAGTTGG - Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055346934 9:75349760-75349782 CAGTGGAGGTGGCGAGGGGTGGG + Intergenic
1055907895 9:81315027-81315049 CAATGGAGATGGATGTCAGTGGG - Intergenic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1057900161 9:98942484-98942506 CAGTGGAGACACAGAGCACTCGG - Intergenic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1058208250 9:102134800-102134822 TACTGGAGAGGGAGAGCATTAGG + Intergenic
1058596962 9:106625282-106625304 AAGTTGAGATGGAGAGCCATGGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1059865593 9:118510531-118510553 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1060157300 9:121328776-121328798 GGGAGGAGAGGGAGAGCAGTTGG + Intronic
1060222400 9:121771701-121771723 CAGGAAAGACGGAGAGCAGTGGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061279077 9:129586730-129586752 CAGTGGAGTTGGGTAGGAGTGGG + Intergenic
1062145428 9:134986854-134986876 CAGGGGAGAGGGATAGCATTAGG + Intergenic
1203464473 Un_GL000220v1:71747-71769 CAGTGCACATTGGGAGCAGTGGG + Intergenic
1186554363 X:10541881-10541903 CAGTGGAGATGCCTAGCAATGGG - Intronic
1186658721 X:11645736-11645758 AAGAGGAGAAGGAGAGGAGTAGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187599008 X:20806023-20806045 CAATGGAGATGGAGGTCATTGGG + Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190467139 X:50736390-50736412 CTGGGGAGATGGAGAGCGTTAGG - Intronic
1191008830 X:55739489-55739511 CAGTTGATTTGGTGAGCAGTGGG - Intronic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191759681 X:64632915-64632937 GAGTGGAGAGGGATAGCATTAGG - Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192221598 X:69200936-69200958 CAGTGAAGATGGAAAACAGCTGG - Intergenic
1192334912 X:70210533-70210555 GAGTGGGGAGGGATAGCAGTAGG - Intergenic
1192844177 X:74888150-74888172 CAGGGGGGAAGGATAGCAGTAGG + Intronic
1193288547 X:79743204-79743226 GAGTGGAGAGGGATAGCATTGGG - Intergenic
1193374374 X:80741040-80741062 GAGGGGGGATGGATAGCAGTAGG - Intronic
1193707275 X:84837128-84837150 CCATGGAGATAGAGAGCAGAAGG + Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1194114016 X:89873612-89873634 CAGTGAAGGTGGGGAGCTGTGGG + Intergenic
1194213700 X:91101060-91101082 ATGTGGAGATGGAGAACATTTGG - Intergenic
1194266449 X:91758676-91758698 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1194286325 X:92014896-92014918 GAGTGGGGATGGATAGCATTAGG + Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198895876 X:141453920-141453942 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1199593366 X:149488258-149488280 GAGTGGAGAGGTCGAGCAGTGGG - Intronic
1199598653 X:149527173-149527195 GAGTGGAGAGGTCGAGCAGTGGG + Intronic
1199599774 X:149535045-149535067 GAGAGGAGAAGGAGAGCAGGAGG - Intergenic
1199644265 X:149890821-149890843 CAGTGGGGAGGGATAGCATTAGG - Intergenic
1199650865 X:149945202-149945224 GAGAGGAGAAGGAGAGCAGGAGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1200466756 Y:3528968-3528990 CAGTGAAGTTGGGGAGCTGTGGG + Intergenic
1200583601 Y:4979245-4979267 GAGTGGGGAGGGAGAGCATTGGG + Intergenic
1200603872 Y:5239435-5239457 GAGTGGGGATGGATAGCATTAGG + Intronic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic
1201685650 Y:16699016-16699038 CGGTGGGGAGGGAGAGCACTAGG + Intergenic
1201780370 Y:17714352-17714374 CAGTGGGGAGGGATAGCATTAGG + Intergenic
1201821184 Y:18191640-18191662 CAGTGGGGAGGGATAGCATTAGG - Intergenic
1201904907 Y:19077856-19077878 CACTGGGCAAGGAGAGCAGTGGG + Intergenic
1202018028 Y:20432710-20432732 GAGTGGAGAGGGATAGCATTAGG + Intergenic
1202065501 Y:20935365-20935387 GAGTGGAGAGGGACAGCATTAGG + Intergenic
1202084671 Y:21123665-21123687 GAGTGGAGAGGGAAAGCATTAGG - Intergenic
1202375106 Y:24227878-24227900 GAGTGGAGAGGGATAGCATTAGG + Intergenic
1202495674 Y:25442242-25442264 GAGTGGAGAGGGATAGCATTAGG - Intergenic