ID: 966505173

View in Genome Browser
Species Human (GRCh38)
Location 3:180692590-180692612
Sequence GTACTCTCCCAGCCAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966505173_966505175 0 Left 966505173 3:180692590-180692612 CCTGAGTTTGGCTGGGAGAGTAC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 966505175 3:180692613-180692635 AAGGAACTACTTGTAATTAGTGG 0: 1
1: 0
2: 0
3: 13
4: 140
966505173_966505176 28 Left 966505173 3:180692590-180692612 CCTGAGTTTGGCTGGGAGAGTAC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 966505176 3:180692641-180692663 TACCAGTAGTTTAACACTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966505173 Original CRISPR GTACTCTCCCAGCCAAACTC AGG (reversed) Intronic
900350854 1:2233907-2233929 GTGCTCTCCCAGACACCCTCAGG + Intronic
900773441 1:4563777-4563799 GTCCTCTCCCTGCCACACCCTGG - Intergenic
903287375 1:22285555-22285577 GAACTCTCCCATCCAAACCGAGG - Intergenic
903728133 1:25467674-25467696 GTACTCTACCAAGCAAACTCTGG - Intronic
910705165 1:90121936-90121958 ATACTCCTCCAGCCAAACTATGG - Intergenic
911191505 1:94953320-94953342 ATAATCTCCCAGCCAAACCAAGG - Intergenic
912941522 1:114049322-114049344 GTACTCTCCCCACCCAACTCAGG + Intergenic
912999451 1:114564931-114564953 GTGCTCTTCCAGCCAAACACAGG - Intergenic
917644976 1:177020927-177020949 GTGCTTTCCCAGCCATACTGAGG - Intronic
920904567 1:210149994-210150016 TTAGTCTCCCAACCAAAATCTGG - Intronic
921365684 1:214371464-214371486 GTACTCACCCAGACCCACTCTGG + Intronic
922231832 1:223693908-223693930 GGACTCTCCCTGGCAAAATCTGG + Intergenic
924514031 1:244751458-244751480 AAACTCTCCCAGGAAAACTCGGG + Intergenic
1065132481 10:22636178-22636200 GTTCTCTCCTGGCCATACTCAGG + Intronic
1072913518 10:99523125-99523147 GTCCTGCCCCAGCCAGACTCCGG - Intergenic
1075252365 10:120891603-120891625 GTATTCTCCCAGCAAAACTTTGG + Intronic
1077229142 11:1450816-1450838 GCTCTCTCCCAGCCCCACTCTGG - Intronic
1077869953 11:6253320-6253342 TTACTCTCACACCCAAACACTGG - Intergenic
1081446347 11:43134790-43134812 TCACTCTCCCATACAAACTCTGG + Intergenic
1088584558 11:111351118-111351140 GTACTCTCTCCTCCAAAATCTGG + Intergenic
1089022254 11:115228375-115228397 CTACCATCCCAACCAAACTCTGG + Intronic
1091710890 12:2739631-2739653 GCCCTCTCCCAGCCAAGCCCTGG + Intergenic
1092412947 12:8268182-8268204 CGACTGTCCCAGCCAAACTCTGG + Intergenic
1098844903 12:75523220-75523242 GGACCCTCCGAGCCAGACTCGGG + Intergenic
1109197841 13:59398332-59398354 GTACTGTGCCAGCCAGCCTCTGG + Intergenic
1110207132 13:72928361-72928383 GGAATCTCCCAGTCAAAATCAGG + Intronic
1115077936 14:29414086-29414108 GGACTCTCCCAGCCAGGCACGGG - Intergenic
1117316489 14:54576090-54576112 GAACTCTCCCATCCAGTCTCTGG - Intronic
1117514621 14:56488518-56488540 AAACTCTCCCAGCTAAACTTGGG - Intronic
1119092990 14:71801692-71801714 GTGCTCTACCAGCCAAAATTGGG + Intergenic
1119329638 14:73784489-73784511 CCACTCTCCCAGCTACACTCTGG + Intronic
1119478481 14:74945638-74945660 CTTCTCTCCCAGCCACACTCAGG + Intronic
1119633666 14:76256612-76256634 TTACTATCCCAGCAAAACCCTGG - Intergenic
1120676831 14:87430562-87430584 GTACCCTCACAGACACACTCAGG - Intergenic
1120853941 14:89196642-89196664 GTATTCTCCCAGCCTTACTAAGG - Intronic
1120874978 14:89367525-89367547 GTCCTCTCCCTGGCAACCTCGGG - Intronic
1121522123 14:94593345-94593367 GCACTCCCCCCGCCAAATTCTGG - Intronic
1125137383 15:36359280-36359302 GTTGTTTCCCAGCCCAACTCAGG - Intergenic
1127111235 15:55673417-55673439 TGACTCTCCCAGCCCCACTCTGG + Exonic
1128753785 15:70167180-70167202 GTGCTCTTCAAGGCAAACTCTGG + Intergenic
1133354150 16:5123686-5123708 TGACTGTCCCAGCCAAACTCTGG + Intergenic
1134327659 16:13221805-13221827 GTCCTCTCCCAGCTAACCCCTGG + Intronic
1135538878 16:23314911-23314933 CTACTATGCCAGCCCAACTCTGG + Intronic
1135587150 16:23679798-23679820 GTCCTCTCTCAGCCCCACTCCGG - Intronic
1138330499 16:56211444-56211466 GTCCCCTCCCAGCCCAGCTCTGG + Intronic
1151760739 17:76101352-76101374 GTACTCTTCCAGCCTACCTGTGG + Exonic
1156949281 18:42873967-42873989 GTGCTCTCCAAGTTAAACTCAGG - Intronic
1157334029 18:46724234-46724256 TTAGTCTCCCAGCCAGACCCTGG + Intronic
1163104341 19:15114882-15114904 GTACTCTCCCACTGGAACTCTGG - Exonic
1164374524 19:27673604-27673626 GGAGACTCTCAGCCAAACTCAGG - Intergenic
925914318 2:8593956-8593978 GTGCTCTCCCAGCCCATCCCTGG + Intergenic
926207460 2:10844221-10844243 GTACTCACCCAGCTCAGCTCAGG - Intergenic
926696023 2:15770713-15770735 CTTCTCCCCCAGCCAGACTCAGG + Intergenic
926921910 2:17947259-17947281 GTCATCTCCCAGCCTCACTCAGG - Intronic
929165216 2:38875266-38875288 ATACTCTTACAGCCAAACTTAGG - Intronic
930691347 2:54368828-54368850 GTACTCTCCCAGCAGAATTGTGG - Intronic
932859791 2:75278223-75278245 GTACTCTCCCACTCTGACTCTGG - Intergenic
938830760 2:135048575-135048597 GTACTCTCTCAGCCTAACAGAGG + Intergenic
1172982823 20:38957395-38957417 GAACTCTGCCAGGCAAACTGGGG - Intergenic
1174116740 20:48231456-48231478 GGACTCTCCCACCCCAACTCTGG + Intergenic
1175552143 20:59824464-59824486 AGGCTCTCCCAGCCAGACTCTGG - Intronic
1178323475 21:31624177-31624199 GTAAATTCCCAGCCATACTCTGG - Intergenic
1178628919 21:34242569-34242591 TTCCTTTCCCAGCCAACCTCTGG - Intergenic
1184289853 22:43492782-43492804 GTCCCCTACCAGCCAAGCTCTGG - Intronic
950027286 3:9828899-9828921 TGTCTCTCCCATCCAAACTCAGG - Intronic
951286622 3:20821179-20821201 GTACCCTCCGAGCCAAGCACGGG + Intergenic
951788270 3:26449019-26449041 GTGCTCTCCCAACCCAACTCTGG + Intergenic
961890510 3:130126835-130126857 CGACTGTCCCAGCCAAACTCTGG + Intergenic
962740155 3:138357430-138357452 GGAGTATCCCAGCCACACTCTGG + Intronic
964147910 3:153488302-153488324 CTACTCTACCAACCAATCTCTGG - Intronic
966505173 3:180692590-180692612 GTACTCTCCCAGCCAAACTCAGG - Intronic
967485752 3:190028423-190028445 GAGGTATCCCAGCCAAACTCTGG + Intronic
967691901 3:192484190-192484212 GTACTCTCTCAGAAAAACACTGG - Intronic
972024252 4:34357606-34357628 GTAGTTTACCAGTCAAACTCTGG + Intergenic
975949246 4:79748048-79748070 GTAATCTCTCAGCTAAATTCTGG - Intergenic
979919086 4:126476607-126476629 CTGCTATCCTAGCCAAACTCTGG - Intergenic
981121395 4:141055259-141055281 GTATTTTTCCAGCCATACTCTGG - Intronic
984507043 4:180633141-180633163 GTTGTTTCCCAGCCAAACACTGG + Intergenic
984703141 4:182831777-182831799 TTACTTTCCCACCCAACCTCTGG + Intergenic
985647434 5:1091546-1091568 GTACTCTGGCACCAAAACTCAGG - Intronic
992982539 5:82191339-82191361 GTACTCCCACAGACCAACTCTGG - Intronic
1000488308 5:161876894-161876916 ATACTGTCCCAGGCAAACTACGG - Intronic
1000588005 5:163123440-163123462 CTACTCTCCCAGCAAATTTCAGG - Intergenic
1002318900 5:178363517-178363539 CTACACTCCCAGCCAGACTCTGG + Intronic
1006135840 6:31896391-31896413 GTAGCCTCATAGCCAAACTCTGG + Exonic
1006385233 6:33727047-33727069 GCACCCTCCCTGCCCAACTCCGG + Intronic
1008340168 6:50354877-50354899 ATACTGTCACAGCCACACTCAGG - Intergenic
1014693820 6:124594629-124594651 TTCCTCTCCCAACCAAACTTTGG - Intronic
1015022894 6:128498189-128498211 GCATTCTCCCATCCAAACTACGG + Intronic
1016700846 6:147052479-147052501 GTCCTCTTACAGCCAAGCTCAGG + Intergenic
1018761583 6:166898563-166898585 GTGCTCTAACACCCAAACTCAGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020107338 7:5428187-5428209 GTCCTTTCCCAGCCAAACAGTGG - Intergenic
1029367321 7:100125009-100125031 GTTCTCTCCCATCTAACCTCAGG + Exonic
1031344732 7:120651402-120651424 GGACTCTCCCAGCCATGCACGGG + Intronic
1034460452 7:151195259-151195281 GTACCTGCCCTGCCAAACTCAGG - Intronic
1035232415 7:157473715-157473737 ATACTTTCCCAGCAAAATTCAGG + Intergenic
1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG + Intergenic
1044905309 8:96994703-96994725 GGACTGTCCCAGACAAACTGGGG - Intronic
1046502875 8:115100807-115100829 GTACTCTCCCTGCCTAAGTATGG + Intergenic
1048354611 8:133642943-133642965 GTTCTCTCAGAGCCCAACTCTGG - Intergenic
1049765448 8:144353288-144353310 GTAACCTCCCAGCCCCACTCTGG - Exonic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1058442188 9:105019820-105019842 GTTATCTCCCAGTAAAACTCTGG + Intergenic
1060323107 9:122584495-122584517 GTACCCTCACAGACAAACCCAGG - Intergenic
1061048454 9:128180221-128180243 GGAAGCTCCCAGCCAGACTCTGG - Intronic
1186375587 X:8995817-8995839 ATACTCTCCCAACTCAACTCAGG + Intergenic
1188029581 X:25249369-25249391 GTATTCTCAAAGCCAAAGTCAGG - Intergenic
1189691247 X:43618625-43618647 GAAGTCTCCCAGGCAATCTCTGG + Intergenic
1196045587 X:111252912-111252934 ATTCTCTCCCAGCCCAACCCTGG - Intronic
1196409400 X:115400145-115400167 TTGCTCTCCCCGCCCAACTCAGG + Intergenic