ID: 966505220

View in Genome Browser
Species Human (GRCh38)
Location 3:180693043-180693065
Sequence ATATACGCATTTGAAAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966505220_966505223 13 Left 966505220 3:180693043-180693065 CCTAACTTTTCAAATGCGTATAT 0: 1
1: 0
2: 5
3: 21
4: 261
Right 966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966505220 Original CRISPR ATATACGCATTTGAAAAGTT AGG (reversed) Intronic
900631553 1:3638970-3638992 AAATACGCATTTGAATATTCCGG - Intronic
901710230 1:11108411-11108433 ATAGTTGGATTTGAAAAGTTTGG + Intronic
904393103 1:30198661-30198683 ATATCCCCATTTGTAAACTTTGG - Intergenic
906934747 1:50203781-50203803 ATAAACACATTTAAAAATTTGGG - Intronic
907288681 1:53398455-53398477 AGATATGCATTTGAAAAGAAAGG - Intergenic
909114089 1:71512887-71512909 ATTTACACATTTTAAAAATTCGG - Intronic
910237684 1:85052075-85052097 GTTTACTCATTTTAAAAGTTTGG + Intronic
910378525 1:86599763-86599785 AAATAAGCATATGAAAAGATGGG + Intergenic
911447103 1:98010510-98010532 ATAAATGCATTTGAATAGTATGG - Intergenic
912424460 1:109574917-109574939 AAATTCGCATTTGATAAGTTGGG - Intronic
916415920 1:164591885-164591907 GTAAAGGCATTTGCAAAGTTGGG + Intronic
917086586 1:171310496-171310518 CAATACCCATATGAAAAGTTTGG - Intergenic
917280368 1:173373532-173373554 CTATACCCGTGTGAAAAGTTTGG - Intergenic
917909304 1:179625501-179625523 ATATCTGCATTTGTGAAGTTGGG - Intronic
918604962 1:186413200-186413222 ATATACTCATTAGAACATTTTGG + Intronic
919015093 1:192022726-192022748 ATATTTGAATGTGAAAAGTTAGG - Intergenic
919587720 1:199459219-199459241 ATATTCACATTTGCAAAGTTGGG - Intergenic
921483715 1:215692265-215692287 ATATATTCTTTTGAGAAGTTTGG + Intronic
921562215 1:216672519-216672541 ATATATACGTTTAAAAAGTTGGG - Intronic
922385563 1:225078116-225078138 ATATACACTTTTGACAAGTATGG + Intronic
922628111 1:227073484-227073506 ATATAATCATTTGAAAATTGTGG - Intronic
923850129 1:237785236-237785258 ATATGCACATTTGAAAAGTTGGG + Intronic
923850299 1:237786722-237786744 ATACGCACATTTGAAAAGTTGGG + Intronic
1062871192 10:906303-906325 AGTTACTCATTTGAAAACTTTGG - Intronic
1063532087 10:6843077-6843099 ATATATCAATTTCAAAAGTTTGG - Intergenic
1063539719 10:6919892-6919914 ATGTTCTCATTTGAAAAGTCAGG + Intergenic
1065529982 10:26659247-26659269 ATTTAAGCATTTGAATAGGTAGG + Intergenic
1065556971 10:26925901-26925923 ATTTAAGCATTTGAATAGGTAGG - Intergenic
1067926630 10:50515054-50515076 AAATAAGGTTTTGAAAAGTTAGG - Intronic
1068125763 10:52840396-52840418 ATCTAAGCATCTGAAAATTTGGG - Intergenic
1068416354 10:56728221-56728243 ACATATGCATTTGAAAATTTGGG - Intergenic
1069272495 10:66547290-66547312 ATATACTCATTTAAAAGATTAGG - Intronic
1069313065 10:67063380-67063402 ATATATGCCTTTAAAAAGTTAGG + Intronic
1070319093 10:75341280-75341302 ATATAAACATTGGCAAAGTTTGG + Intergenic
1070481115 10:76883657-76883679 GTATATACATTTAAAAAGTTAGG - Intronic
1071787591 10:88919681-88919703 AGATTTGCATTTTAAAAGTTAGG + Intronic
1072254060 10:93603664-93603686 ATATACCCAGTGGAAAAGTGGGG - Intronic
1072371174 10:94767706-94767728 CAATACCCATATGAAAAGTTTGG + Intronic
1072868856 10:99094883-99094905 ATTTCCGCTTTAGAAAAGTTTGG + Intronic
1072887653 10:99293430-99293452 AAATAAGAATTTGAAAACTTGGG + Intergenic
1077698059 11:4413055-4413077 ATATTGGCATTTCAAAGGTTGGG - Intergenic
1079495962 11:21044419-21044441 AGCAACGCATTTGAGAAGTTTGG + Intronic
1080079670 11:28201416-28201438 TTATAAACAATTGAAAAGTTGGG - Intronic
1080370782 11:31639935-31639957 ATTGATACATTTGAAAAGTTTGG - Intronic
1081153042 11:39655750-39655772 GTATAAGCATTTGAATAATTTGG - Intergenic
1081599974 11:44486158-44486180 ATACACACATTTGCAAAGATTGG - Intergenic
1082166111 11:48953616-48953638 ATATATGCATTTGAAAAATTAGG - Intergenic
1082237087 11:49831346-49831368 ACATATGCATTTGAAAAATTAGG + Intergenic
1082241607 11:49878353-49878375 GTATATGCATTTGAAAAATTAGG - Intergenic
1085945799 11:81271102-81271124 ATATATGCATATCTAAAGTTGGG + Intergenic
1086054029 11:82627001-82627023 CAATACTCATATGAAAAGTTTGG - Intergenic
1086361698 11:86067806-86067828 ATATCCCCATGTGAAAAGCTGGG + Intronic
1086932395 11:92706772-92706794 ATATGCACATTTTAAAAGATGGG - Intronic
1087202895 11:95364101-95364123 ATAAACACATTTGAAAAAATAGG + Intergenic
1087480630 11:98695526-98695548 ATATATCCATTTTAAAAATTTGG - Intergenic
1087648633 11:100838103-100838125 ATTGACGTGTTTGAAAAGTTTGG + Intronic
1087682852 11:101235002-101235024 CAATACCCATATGAAAAGTTTGG + Intergenic
1088142893 11:106639030-106639052 ATATAGGCTTTTAAAAATTTCGG + Intergenic
1092623973 12:10305290-10305312 AAATTTGCTTTTGAAAAGTTAGG - Intergenic
1093345742 12:18036942-18036964 CAATACCCATGTGAAAAGTTTGG - Intergenic
1093724504 12:22488314-22488336 ATATAAGAATTTGAAAAGGATGG + Intronic
1094168969 12:27471296-27471318 GCATACGCATTTGTAAACTTTGG + Intronic
1094257838 12:28455216-28455238 ATAAACTTATTTGAAAATTTTGG - Intronic
1095276118 12:40284503-40284525 ATGTAAGCATATAAAAAGTTAGG - Intronic
1095517809 12:43026282-43026304 AAATACGGATTTGAAAAATAAGG - Intergenic
1096963874 12:55608632-55608654 ATATATGAATTTATAAAGTTTGG - Intergenic
1097488174 12:60232495-60232517 ATATAGGACTTTGAAAAGCTTGG + Intergenic
1101056957 12:100927478-100927500 ATGTTCGGATTTGAAAACTTTGG - Intronic
1101869685 12:108555100-108555122 ATATATGCAAATGAAAACTTTGG + Intronic
1105523353 13:21151828-21151850 ATTTCCCCATTTGAAAAATTAGG + Intergenic
1109107053 13:58266658-58266680 ATATAGTCATTTAAAAATTTTGG - Intergenic
1109424913 13:62155917-62155939 CAATACCCATATGAAAAGTTTGG - Intergenic
1109511190 13:63376731-63376753 ATATAAGTAATTGCAAAGTTTGG - Intergenic
1109874590 13:68383877-68383899 ATATATGTATTTGGACAGTTAGG - Intergenic
1110898818 13:80793928-80793950 ATAGATACATTTGTAAAGTTGGG + Intergenic
1111699503 13:91668451-91668473 ATACATGCATTTGAGAATTTGGG - Intronic
1115058468 14:29160533-29160555 ATACAGGCCTTTGAACAGTTAGG - Intergenic
1116604588 14:46973602-46973624 ATATATGCATTTAAAAATGTAGG + Intronic
1117737081 14:58778537-58778559 ATGTATGCATTTGTAAACTTGGG - Intergenic
1118504800 14:66399617-66399639 ATATACAAAAATGAAAAGTTGGG + Intergenic
1118658859 14:67985013-67985035 GTTTCCGCATTTGTAAAGTTAGG + Intronic
1120236854 14:81902816-81902838 ATCTTCACATTTGAAAAGGTAGG + Intergenic
1120804676 14:88734188-88734210 ATTTACCAATTTTAAAAGTTAGG - Intronic
1126070931 15:44864230-44864252 CAATACCCATATGAAAAGTTTGG + Intergenic
1126245121 15:46495852-46495874 ATATATGTATTTCAATAGTTTGG - Intergenic
1126412959 15:48390783-48390805 ATAAACTCATTTTCAAAGTTGGG + Intergenic
1126752217 15:51888143-51888165 ATATACACTTCAGAAAAGTTGGG - Intronic
1129857123 15:78832324-78832346 GTTTCCCCATTTGAAAAGTTTGG + Intronic
1130215853 15:81968699-81968721 ATTTCCTCATTTTAAAAGTTGGG - Intergenic
1131966817 15:97853089-97853111 ATATTCTCATTCTAAAAGTTAGG + Intergenic
1134302393 16:13003417-13003439 ACAGCAGCATTTGAAAAGTTTGG - Intronic
1139897878 16:70302495-70302517 ATATAACCTTTTGAAAAGTCTGG + Intronic
1142019629 16:87773324-87773346 ATATACTCATTTTCAAAATTTGG + Intergenic
1144300437 17:13918724-13918746 ATATACGGATTTGAGAAGAGAGG - Intergenic
1145804575 17:27717363-27717385 CAATACCCATATGAAAAGTTTGG - Intergenic
1149074376 17:52578814-52578836 CAATACCCATATGAAAAGTTTGG - Intergenic
1149213721 17:54330792-54330814 CAATACCCATATGAAAAGTTTGG - Intergenic
1153394370 18:4601922-4601944 AAATAGACATTTGACAAGTTTGG - Intergenic
1155234081 18:23802130-23802152 AAATACTCATTGGAAAATTTTGG + Intronic
1155868929 18:31001539-31001561 ATAAACTCATTTCAAAATTTAGG - Intronic
1157290739 18:46407806-46407828 ATCCACCCATGTGAAAAGTTGGG + Intronic
1157367837 18:47082583-47082605 ATATACTTATTTGAAAAGATTGG - Intronic
1157529935 18:48411294-48411316 ACATGTGCATTTGAATAGTTTGG - Intergenic
1159988267 18:74871707-74871729 ATATACTAATTTGAAAAGACTGG + Intronic
1162236953 19:9316998-9317020 CAATACCCATATGAAAAGTTTGG + Intergenic
1162731927 19:12723479-12723501 TTATACCCATTTGACAAGTGGGG - Intronic
1164221236 19:23196145-23196167 ATATATGATTTTAAAAAGTTTGG + Intergenic
1165976835 19:39683406-39683428 ATCTGCCCATTTGAAAAGATTGG - Intergenic
1165982366 19:39735485-39735507 TTATACGTATTTGGAGAGTTGGG + Intronic
925762791 2:7202349-7202371 ATATATACATTTGATGAGTTGGG + Intergenic
925953242 2:8935944-8935966 ATATACTTATTTTAAAAATTGGG - Intronic
926350066 2:11986132-11986154 ATGTTCTCATTTGAAAAGTAAGG + Intergenic
928566110 2:32551680-32551702 ATATACGCAAATGAAAAAATTGG - Intronic
929650494 2:43675928-43675950 AAATACGTCTTTGAAAAGTATGG - Intronic
930284596 2:49412128-49412150 ATAAACACATTAGAAAAGTCTGG - Intergenic
934585805 2:95493462-95493484 ATATACACATTAGAAAAATTAGG + Intergenic
934590096 2:95540995-95541017 ATATATGCATTTGAAAAATTAGG + Intergenic
934593660 2:95583308-95583330 ATTTACACATTTGAAAAATTAGG - Intergenic
936459194 2:112699556-112699578 ACATACGACTTTGAAAAGTGAGG - Intergenic
937329214 2:121014895-121014917 ATTTACCCATTTAAAAAATTGGG - Intergenic
937523397 2:122738381-122738403 ATCTACACATATGAAAAGTTGGG - Intergenic
938112150 2:128575644-128575666 ATATATCCCATTGAAAAGTTTGG - Intergenic
939412185 2:141842414-141842436 ATTTACCTATTTGAAAAGTAAGG - Intronic
940666173 2:156612807-156612829 ATTTAAGCAATTGAAAACTTGGG - Intronic
941256628 2:163240699-163240721 ATCTGCGCATTTGAAAATGTAGG + Intergenic
941515341 2:166467305-166467327 ATACACCTATTTTAAAAGTTTGG - Intronic
941605134 2:167587428-167587450 TTATACTCATTTTATAAGTTAGG + Intergenic
942055068 2:172174537-172174559 ATTTACACATTTTAAAAGGTAGG - Intergenic
942226336 2:173819800-173819822 ATATAAGCATGTCAAAACTTTGG + Intergenic
943174386 2:184451314-184451336 ATATACTCATTTGGAAAGCCAGG + Intergenic
943398038 2:187366650-187366672 ATATTCACATGTGAAAAGATTGG + Intronic
945436720 2:209827193-209827215 ATATACACATGTGCAAAGATGGG - Intronic
946206320 2:218111533-218111555 CAATACCCATATGAAAAGTTTGG + Intergenic
948614882 2:239192021-239192043 ATACATGCATTTTAAAAGTTGGG - Intronic
1169991519 20:11508958-11508980 ATAAAAGCATTTTAAAAGCTGGG + Intergenic
1173092885 20:39992224-39992246 ATATAAGCATTTTAATATTTAGG + Intergenic
1184076575 22:42183140-42183162 TTTTCCGCATCTGAAAAGTTGGG - Intronic
949103481 3:174884-174906 ATATACACATGTGGAAAATTGGG + Intergenic
949220010 3:1620726-1620748 ACATAAGCATTTGAAAATTTCGG - Intergenic
951852588 3:27158749-27158771 ATATTTGCACTTGAAAATTTAGG + Intronic
953013978 3:39054875-39054897 AAATATGCATTTTAAAAGTCAGG + Intronic
954231873 3:49224064-49224086 CAATACCCATATGAAAAGTTTGG + Intronic
956044870 3:65184865-65184887 ATAGACACAGTTGAAGAGTTAGG - Intergenic
957756959 3:84502276-84502298 AGATATGGATTTGAAAAATTAGG + Intergenic
957774738 3:84742603-84742625 AAATTAACATTTGAAAAGTTTGG + Intergenic
958707615 3:97675590-97675612 ATATAAGCAATTATAAAGTTAGG - Intronic
959072614 3:101716909-101716931 ATATTCTCAATTGAAAATTTAGG + Intergenic
959217521 3:103470991-103471013 ATATATGCATTGTAAAAGTTTGG + Intergenic
959872002 3:111339413-111339435 AAATACTCTTTTGAAATGTTTGG + Intronic
959929962 3:111969577-111969599 ATATAGGCATTTTAAAGCTTAGG + Intronic
960535639 3:118812024-118812046 ACATACACATTTCAAAATTTGGG + Intergenic
962328721 3:134458295-134458317 AAAGACTCATTTGTAAAGTTTGG - Intergenic
963821510 3:149899924-149899946 ATATACGAATCTGGAGAGTTTGG + Intronic
964916518 3:161848110-161848132 CAATACCCATATGAAAAGTTTGG + Intergenic
965063205 3:163807230-163807252 CAATACCCATATGAAAAGTTTGG - Intergenic
965356280 3:167677037-167677059 ATATATTTAATTGAAAAGTTTGG + Intergenic
965510847 3:169566566-169566588 ATATTCTCATCTGCAAAGTTGGG - Intronic
965769632 3:172168149-172168171 ATATAACAATTTGAAAAGTGAGG - Intronic
966293247 3:178385894-178385916 ATCTATGAATTTTAAAAGTTTGG - Intergenic
966296527 3:178430057-178430079 ATATTCTCATTTAAAAAGTGTGG - Intronic
966505220 3:180693043-180693065 ATATACGCATTTGAAAAGTTAGG - Intronic
969087564 4:4667772-4667794 ATATTAGCATTCGAAAAGCTGGG - Intergenic
970107793 4:12604487-12604509 ATATACACATTTTAAAATTGTGG + Intergenic
970387257 4:15568177-15568199 AAATAGGCATTTCAGAAGTTTGG + Intronic
971730423 4:30371562-30371584 ATATATTCATTTGAAATGTCAGG - Intergenic
972328518 4:38041471-38041493 ATAGACTCATGTGAAATGTTTGG - Intronic
974424607 4:61725273-61725295 GTTTCCCCATTTGAAAAGTTGGG + Intronic
974527012 4:63058499-63058521 CAATACCCATATGAAAAGTTTGG - Intergenic
974700461 4:65437751-65437773 ATATAGTCATTTGTAAAATTGGG + Intronic
974706665 4:65526717-65526739 ATCTACACATATGCAAAGTTTGG - Intronic
975667626 4:76748638-76748660 CTATTGCCATTTGAAAAGTTTGG + Intronic
975931642 4:79531203-79531225 ATAAATGCATTTAAAAAGATAGG - Intergenic
976273280 4:83251152-83251174 AGATACACATTAGAAAAGTGTGG + Intergenic
977028301 4:91849036-91849058 ATACACACATTTGGACAGTTTGG + Intergenic
977094825 4:92727911-92727933 ATATACGGCTTTGCAAATTTGGG + Intronic
977282284 4:95056015-95056037 AGATATGCATTTGAAAAGTTGGG - Intronic
977884648 4:102241748-102241770 CAATACCCATATGAAAAGTTTGG - Intergenic
978531432 4:109718428-109718450 ACATACATAGTTGAAAAGTTTGG - Intronic
979011316 4:115373669-115373691 ACATATGCATTTCAAAAATTAGG + Intergenic
979083930 4:116381091-116381113 AAATATGCAATTGAAAATTTTGG + Intergenic
979643850 4:123043434-123043456 ATATATACAATTGAAAAGTCAGG - Intronic
980656846 4:135799618-135799640 ATGTATGTATTTGAAAACTTAGG + Intergenic
981259798 4:142706129-142706151 ATAATTGCATTTGCAAAGTTTGG - Intronic
982111786 4:152063287-152063309 AAAGAGGCATTTGAAAATTTGGG + Intergenic
983294410 4:165847815-165847837 ATATGGACATTTGAAAAGTTAGG + Intergenic
983767038 4:171497381-171497403 AGATACACAGTTGCAAAGTTCGG + Intergenic
983882066 4:172944287-172944309 ATTTACCCATTTTAAAAATTGGG - Intronic
984001767 4:174255050-174255072 ATTAACGGCTTTGAAAAGTTAGG + Intronic
984503854 4:180592101-180592123 TTAAAAGCATTTTAAAAGTTTGG + Intergenic
984939471 4:184918673-184918695 CAATACCCATATGAAAAGTTTGG + Intergenic
986421675 5:7590815-7590837 TTCTAGGCATTTAAAAAGTTTGG + Intronic
986920972 5:12680602-12680624 AATAACACATTTGAAAAGTTGGG + Intergenic
989478488 5:41901565-41901587 ATATACTCAATTTAAAAGATGGG - Intergenic
989610715 5:43287923-43287945 ATCTACGCATCAGAAATGTTGGG - Intergenic
992040942 5:72831372-72831394 GTATCAGCATTTGAAAAATTAGG + Intronic
992049842 5:72931962-72931984 CAATACCCATATGAAAAGTTTGG - Intergenic
992061853 5:73058310-73058332 ATATACATAATTAAAAAGTTAGG - Intronic
992252843 5:74892859-74892881 ATATCAGCATTTGAAAAGATGGG - Intergenic
992465764 5:77002556-77002578 ATAGAGGAATTTTAAAAGTTTGG - Intergenic
993567887 5:89497883-89497905 AAGTACGCTTTTGAAAAATTTGG - Intergenic
994231269 5:97312622-97312644 CAATACCCATATGAAAAGTTTGG + Intergenic
994254492 5:97577551-97577573 ATTTACCCATGTGAAAATTTAGG + Intergenic
995706893 5:114996046-114996068 CAATACCCATATGAAAAGTTTGG - Intergenic
996381771 5:122869067-122869089 ATATTCACATTTTAAAAATTTGG - Intronic
996680688 5:126225835-126225857 CAATACCCATATGAAAAGTTTGG - Intergenic
996808464 5:127485716-127485738 ATAGGCTCATGTGAAAAGTTAGG + Intergenic
997072771 5:130638631-130638653 CAATACCCATCTGAAAAGTTTGG - Intergenic
997850006 5:137323640-137323662 AAATACCCATTTTAAAAATTGGG - Intronic
998713397 5:144851214-144851236 CAATACCCATATGAAAAGTTTGG + Intergenic
1000488140 5:161874242-161874264 ATGTTTGCATTTGAAAAGCTAGG - Intronic
1000739495 5:164949762-164949784 CTTTAGGCATTTTAAAAGTTAGG + Intergenic
1003702259 6:8480839-8480861 ATTTCCACATTTGCAAAGTTGGG - Intergenic
1003774233 6:9341314-9341336 ATATATCCATTTAAAAAGTCCGG + Intergenic
1003783746 6:9459641-9459663 ATATACGAACTTTAAAAATTAGG - Intergenic
1005381907 6:25244071-25244093 ATATTAGCATTTGAATAGTAGGG - Intergenic
1005777661 6:29154060-29154082 ATATATACTTTTTAAAAGTTTGG + Intergenic
1005855796 6:29862172-29862194 AAATACATATTTGAAAAGTCTGG - Intergenic
1006201843 6:32300140-32300162 ATATAGGCATTTGAAATCTTGGG + Intronic
1007030505 6:38622061-38622083 TAATACCCATATGAAAAGTTTGG - Intronic
1009531074 6:64816287-64816309 ATATACGCATTTAAAAACACTGG - Intronic
1009847216 6:69149616-69149638 GTCTGGGCATTTGAAAAGTTAGG + Intronic
1011374589 6:86675703-86675725 CAATACCCATATGAAAAGTTTGG + Intergenic
1013907382 6:115235494-115235516 CAATACCCATATGAAAAGTTTGG + Intergenic
1013996779 6:116318203-116318225 TTATGCACATTTGAAAAGTAGGG + Intronic
1016022342 6:139249382-139249404 TTATACCCATTTGAAGACTTGGG - Intronic
1019867238 7:3723348-3723370 ATATAAGCCTTTGAAAAATACGG + Intronic
1020237654 7:6368801-6368823 AAATACTCAGTTGAAAAGCTGGG - Intergenic
1020925889 7:14324147-14324169 ATATATGCATATGAAAGTTTTGG + Intronic
1021002034 7:15342878-15342900 ATATCCTCATTTGAGAAGTGTGG + Intronic
1021863685 7:24932815-24932837 ATTCAAGCATTTGAAATGTTGGG + Intronic
1021972916 7:25983098-25983120 ATATACTAATATGAAAATTTTGG + Intergenic
1022243090 7:28531610-28531632 ATATATGAATTTGAAAAGGAGGG + Intronic
1022675054 7:32491644-32491666 ATATACCCATTGGAAAAAATGGG + Intronic
1023156965 7:37260915-37260937 GTATATCCATTTGAAAATTTTGG - Intronic
1026208733 7:68282060-68282082 ACATAAACATTTGAAAACTTTGG + Intergenic
1027438616 7:78194467-78194489 ATATAGCCATTTAAAAAGTTAGG - Intronic
1027757818 7:82237644-82237666 GTATAAGCATTTGCAAAGATAGG + Intronic
1027791431 7:82641814-82641836 CAATACCCATATGAAAAGTTTGG - Intergenic
1027927247 7:84482085-84482107 ATATAGGCATTTGAAAAATTAGG + Intronic
1028003256 7:85528915-85528937 ATTTAGGCATATGAAAATTTAGG - Intergenic
1028494778 7:91450679-91450701 CAATACCCATATGAAAAGTTTGG + Intergenic
1028873004 7:95789223-95789245 AAATACCCATCTGAAAAGCTTGG - Intronic
1031524191 7:122804733-122804755 ATATAAGAATTTGAAAAGGATGG - Intronic
1032708124 7:134439868-134439890 ATATACTGATTTCAAAACTTGGG + Intergenic
1033123641 7:138688105-138688127 ATTTGCCCATTTGAAAAATTAGG - Intronic
1033243546 7:139700529-139700551 AAATACCCATTTAAGAAGTTGGG - Intronic
1033532990 7:142285002-142285024 ATATACGAATTTGGGAAGTGGGG - Intergenic
1034006823 7:147482291-147482313 ATATATATATTTTAAAAGTTAGG - Intronic
1034143334 7:148844260-148844282 ATATTCTCATCTGAAAAGTCAGG + Intronic
1034342520 7:150367399-150367421 ATTTGCCCATTTTAAAAGTTGGG - Intergenic
1037425746 8:18752457-18752479 ATATATATATTTGAAAAGTTAGG - Intronic
1038251893 8:25912743-25912765 AGAAACGTATTTGAATAGTTTGG - Intronic
1038430337 8:27494766-27494788 CAATACCCATATGAAAAGTTTGG + Intronic
1039692727 8:39879831-39879853 CAATACCCATATGAAAAGTTTGG + Intergenic
1039999232 8:42562490-42562512 CAATACCCATATGAAAAGTTTGG + Intergenic
1040918541 8:52589742-52589764 TGATACGCATATGAACAGTTTGG + Intergenic
1041351887 8:56955383-56955405 AGATATGCATTTGAAAATATCGG + Intergenic
1042908828 8:73803534-73803556 AGATAGGTGTTTGAAAAGTTTGG - Intronic
1042920059 8:73911651-73911673 CAATACCCATATGAAAAGTTTGG - Intergenic
1044005009 8:86928852-86928874 CAATACCCATATGAAAAGTTTGG + Intronic
1044328268 8:90885595-90885617 ATATACACATTTCAAAAATGAGG + Intronic
1044391314 8:91655217-91655239 TTATATGCATTTTAAAAATTTGG - Intergenic
1046364562 8:113209906-113209928 ATACAGGCATTTTTAAAGTTTGG - Intronic
1046857318 8:119047984-119048006 ATAAGAGTATTTGAAAAGTTGGG + Intronic
1048478181 8:134762050-134762072 TTAAACGTATTTGAGAAGTTTGG - Intergenic
1049917240 9:329828-329850 ATTTATACATTTGAAAATTTTGG - Intronic
1051683632 9:19634156-19634178 ATATACCCATTTTAAAGATTGGG + Intronic
1055000594 9:71445557-71445579 ATATAAACATTTGAAATTTTTGG - Intronic
1055119992 9:72648716-72648738 ATAAAGGTATTTGAAAACTTTGG + Intronic
1056392328 9:86151634-86151656 CAATACCCATATGAAAAGTTTGG + Intergenic
1056745123 9:89294992-89295014 ATATACTAATTTGAAAACCTAGG - Intergenic
1058246922 9:102638314-102638336 ATAAATACATTTGGAAAGTTGGG - Intergenic
1059672504 9:116504956-116504978 ATATACTCATTTGTAAATTTGGG - Intronic
1060390660 9:123273775-123273797 ATATATACATAGGAAAAGTTTGG - Intergenic
1186563288 X:10635336-10635358 TTAGAAGCATTTGAAATGTTTGG - Intronic
1187978774 X:24732253-24732275 TTAAACACATATGAAAAGTTTGG - Intronic
1188021810 X:25167010-25167032 ATATATTCATAGGAAAAGTTAGG + Intergenic
1188919117 X:35949850-35949872 ATATCAGCATTCAAAAAGTTTGG + Intronic
1188960809 X:36488986-36489008 ATATACGGATTTGAAAATGTGGG + Intergenic
1189440801 X:41034253-41034275 CTTTATGCATTTGAAAAATTTGG + Intergenic
1195754331 X:108186302-108186324 ATATAGGTATTTGAAAAACTAGG + Intronic
1196489185 X:116247365-116247387 CAATACCCATATGAAAAGTTTGG - Intergenic
1196661891 X:118279051-118279073 CAATACCCATATGAAAAGTTTGG + Intergenic
1199387467 X:147239764-147239786 ATATATACAGTTGATAAGTTTGG + Intergenic
1199408822 X:147495177-147495199 AGATACCCATTTGCAAGGTTTGG - Intergenic
1201455542 Y:14163911-14163933 CAATACCCATATGAAAAGTTTGG - Intergenic
1201496189 Y:14593441-14593463 CAATACCCATATGAAAAGTTTGG + Intronic
1201530912 Y:14988959-14988981 CCATACCCATATGAAAAGTTTGG - Intergenic