ID: 966505223

View in Genome Browser
Species Human (GRCh38)
Location 3:180693079-180693101
Sequence CCTAACAACCACACTCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966505220_966505223 13 Left 966505220 3:180693043-180693065 CCTAACTTTTCAAATGCGTATAT 0: 1
1: 0
2: 5
3: 21
4: 261
Right 966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966505223 Original CRISPR CCTAACAACCACACTCCTTA AGG Intronic
901290755 1:8122480-8122502 ACTAACAACCACATACCTAAAGG + Intergenic
902208437 1:14887024-14887046 CCTCACAACCACACTCGTGGGGG - Intronic
903468441 1:23568382-23568404 CCGAACAGCCACATTCCTTCGGG - Intergenic
904954401 1:34270992-34271014 CACACCAACCACACTCCTTGAGG - Intergenic
908108422 1:60870959-60870981 ATTAACACCCTCACTCCTTATGG - Intronic
916241551 1:162644890-162644912 CCAGCCAACCACACTTCTTAAGG + Intronic
918197157 1:182233352-182233374 CCTAACCACATCACTCCTGATGG + Intergenic
923928105 1:238659044-238659066 ACTGACAAACACACTCCTTATGG - Intergenic
924205826 1:241710590-241710612 ACTAACAACCATCCTCCTTTGGG - Intronic
1065735225 10:28745371-28745393 CCTAACTTCCAAACTCCTTGGGG - Intergenic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1085431631 11:76455586-76455608 CCTTTCAACCACATTCCTTCAGG - Intronic
1090085667 11:123648765-123648787 CATGACAAACACACTCCTTTGGG - Intronic
1090633453 11:128670755-128670777 CCTGATAACCACACGTCTTAGGG + Intergenic
1090947508 11:131444658-131444680 CCCCACAACCACACTTCTTAAGG - Intronic
1092957224 12:13561940-13561962 CCAAACAATCACACTGCTTGGGG + Exonic
1094738079 12:33258399-33258421 CCTTACAACCAAAATGCTTATGG - Intergenic
1095187400 12:39216689-39216711 CCTAACCCCCACACTGCTCAAGG + Intergenic
1095287866 12:40437588-40437610 GCTAAATACCAAACTCCTTAAGG + Intronic
1100398511 12:94206004-94206026 CACAACAACCTCACTCTTTACGG - Intronic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1101569609 12:105941036-105941058 CCAAACAAGCTCCCTCCTTATGG + Intergenic
1103011426 12:117461289-117461311 CCTAACAAACAAACTCATTGGGG + Exonic
1105531441 13:21224291-21224313 CCTCAGAACCACAGTCGTTAGGG + Intergenic
1107524286 13:41214475-41214497 CCTAGCAACTACAGTCCTTGTGG + Intergenic
1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG + Intergenic
1108885083 13:55170403-55170425 CCTAATATCCACAATCCATAAGG + Intergenic
1109128397 13:58547814-58547836 CCTAACATCCAGAATCCTTCTGG + Intergenic
1109432506 13:62253647-62253669 CCTAACATCCACAATCTTTACGG - Intergenic
1113559774 13:111269471-111269493 CCTGACAAACACACTCATTAAGG - Intronic
1113877599 13:113604426-113604448 ACTCACACCCACACTCCTAAGGG + Intronic
1118994017 14:70821340-70821362 CATAAAACCCACACTCCCTAAGG - Intergenic
1122257053 14:100486188-100486210 CCTGACAACCACGTCCCTTATGG + Intronic
1129919767 15:79310684-79310706 CCTAACATCCACAGTAGTTAGGG - Intergenic
1133492753 16:6286581-6286603 AGTAACAACCACACTTATTAAGG - Intronic
1134760223 16:16707934-16707956 CCTAATTATCACAGTCCTTAAGG - Intergenic
1134985849 16:18651271-18651293 CCTAATTATCACAGTCCTTAAGG + Intergenic
1136821862 16:33325358-33325380 CCTAATATCCAGACTCCATAGGG + Intergenic
1136828425 16:33381897-33381919 CCTAATATCCAGACTCCATAGGG + Intergenic
1136833491 16:33480669-33480691 CCTAATATCCAGACTCCATAGGG + Intergenic
1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG + Exonic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1142324775 16:89407517-89407539 CCTAAGAAACAAACTCCTTCTGG + Intronic
1202993963 16_KI270728v1_random:38253-38275 CCTAATATCCAGACTCCATAGGG + Intergenic
1203011425 16_KI270728v1_random:243852-243874 CCTAATATCCAGACTCCATAGGG - Intergenic
1146939724 17:36836127-36836149 CCTCACACACACACTCCTCAGGG - Intergenic
1151637899 17:75365011-75365033 CCTAACACCCAAACTTCTAATGG + Intronic
1157200494 18:45655123-45655145 CCTAACAACCTGTCTCCTCAGGG + Intronic
1157955286 18:52090151-52090173 CCTAACAACCCAAGCCCTTAAGG + Intergenic
1167332896 19:48867451-48867473 CTTAACAACCAGAGTCCTTGGGG + Intronic
925497633 2:4469849-4469871 CCAAACACACACACACCTTATGG - Intergenic
926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG + Intergenic
926383939 2:12317507-12317529 CCTCACACCCACACTGCTTCTGG - Intergenic
926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG + Intergenic
928416699 2:31098628-31098650 CCTAACCCCCACACTGCTCAAGG - Intronic
929245951 2:39703815-39703837 CCTAAACACAAAACTCCTTAAGG - Intronic
929615180 2:43301135-43301157 GCTGAGAACCACACTCCTCAGGG + Intronic
935447436 2:103171618-103171640 TCTAAAAAACACACTCTTTAAGG - Intergenic
936039712 2:109140992-109141014 CCTGACAACCAGACTCCTGTTGG + Intronic
939070801 2:137539397-137539419 CCTAACAACCAAACAGCATAAGG - Intronic
940488301 2:154324795-154324817 CCAAGCAACCACACTCCTGCCGG - Intronic
941892169 2:170594031-170594053 CCTAACATACACACTGTTTATGG + Intronic
942632416 2:177965248-177965270 CCTAACATCCAGAATCTTTAAGG - Intronic
944857463 2:203781899-203781921 CCTAATAACAAAATTCCTTAAGG - Intergenic
946035963 2:216742465-216742487 CCTAAATACCACTCTCCTTCAGG - Intergenic
1170612526 20:17926279-17926301 CCTAACACCCCAACTCCTGAGGG + Intergenic
1170806174 20:19633828-19633850 CATAACAAGCACCCTTCTTAAGG + Intronic
1175543054 20:59760172-59760194 CCTGACACCCACACTCATCATGG - Intronic
1179166951 21:38942881-38942903 CCTAGCAACCAGACTGCTAAGGG - Intergenic
1181549938 22:23632085-23632107 CCTAGCAGCCACACTACTGAGGG + Exonic
1181798451 22:25327441-25327463 CCTAGCAGCCACACTACTGAGGG - Intergenic
1181952799 22:26566775-26566797 ACAAACAAACAAACTCCTTAAGG + Intronic
965686493 3:171308669-171308691 CCTAATATCCAGACTCCATAGGG + Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
969892986 4:10276852-10276874 CCTGACAACCACACGCCCTGGGG - Intergenic
977907603 4:102496608-102496630 CCTAACAAACACATTCTCTAAGG + Intergenic
983388840 4:167102799-167102821 CCTAGCAATTACAGTCCTTATGG - Intronic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986322754 5:6646403-6646425 CCTACCAACCAAATTCCTCAAGG - Intronic
989099749 5:37812799-37812821 CCAAACAAGTGCACTCCTTACGG + Intronic
997554686 5:134785418-134785440 CCTAACCACCAAAATTCTTAAGG - Intronic
1005786213 6:29248303-29248325 CCTAACAAAGGCCCTCCTTAAGG - Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1006295000 6:33166401-33166423 CCTAACAAGCATAGTCCTCAGGG - Intronic
1007083234 6:39123767-39123789 CCTAGCTCCCTCACTCCTTATGG + Intergenic
1007816119 6:44526838-44526860 CCTAATAACCCCATTCATTAAGG - Intergenic
1017031257 6:150224871-150224893 CCTTACTACCACACTACTTAAGG - Intronic
1018687163 6:166312273-166312295 CCTAACCCCCACATTGCTTAGGG + Intergenic
1018939561 6:168300079-168300101 CCTTAGGACAACACTCCTTACGG - Intronic
1020980864 7:15066715-15066737 ACTAACAACCAAACTCTATATGG + Intergenic
1021049979 7:15971240-15971262 CCTAAAAACTAAACTCCTGAAGG + Intergenic
1024093122 7:45963829-45963851 CCAAACATACACAATCCTTAGGG - Intergenic
1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG + Intergenic
1034303996 7:150036796-150036818 CCTAACACCCACAGTCCTCCAGG + Intergenic
1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG + Intergenic
1044038754 8:87338857-87338879 CCTTACAACCACATTACTAAAGG - Intronic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1046652078 8:116847012-116847034 CCTGTTAACCACTCTCCTTAGGG - Exonic
1052033238 9:23651743-23651765 CTTAACTACCACATCCCTTAAGG - Intergenic
1053589952 9:39502547-39502569 TCTAACAATCCCACTTCTTATGG + Intergenic
1054576348 9:66862744-66862766 TCTAACAATCCCACTTCTTATGG - Intronic
1059313246 9:113402774-113402796 GCTAATAACCACACTCCATAGGG + Intergenic
1059819228 9:117953426-117953448 CATAACATACAAACTCCTTATGG - Intergenic
1060558510 9:124522954-124522976 CCTAACATCCAGACCCCTTTGGG + Intronic
1060581475 9:124750916-124750938 CCTAAATACTAGACTCCTTAAGG + Intronic
1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG + Intronic
1185919138 X:4069721-4069743 CCTAACAATCCCACTCCTACAGG - Intergenic
1186528162 X:10268572-10268594 CATAACACCCACCCTCCTTTGGG - Intergenic
1196850123 X:119929672-119929694 CCTAACTGCCACATTCCTCATGG + Intronic
1198005902 X:132492172-132492194 CCTGACAACCACTATCCTGATGG + Intergenic