ID: 966505261

View in Genome Browser
Species Human (GRCh38)
Location 3:180693562-180693584
Sequence TTGTGCTGTGCTCACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966505261_966505265 -4 Left 966505261 3:180693562-180693584 CCATCCATGTGAGCACAGCACAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 966505265 3:180693581-180693603 ACAAAAACAAGGCTGGTATGAGG 0: 1
1: 0
2: 1
3: 22
4: 396
966505261_966505266 27 Left 966505261 3:180693562-180693584 CCATCCATGTGAGCACAGCACAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 966505266 3:180693612-180693634 TGAACTTCCATGCTGCTATATGG 0: 1
1: 0
2: 1
3: 19
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966505261 Original CRISPR TTGTGCTGTGCTCACATGGA TGG (reversed) Intronic
901066752 1:6497885-6497907 TTGAGCTGTGCTCACAGGACAGG - Intronic
901871522 1:12141467-12141489 CTGTGCTGTGAGCACATGGTGGG - Intronic
902112152 1:14090785-14090807 TTGATCTGTGTTCACATGGGAGG - Intergenic
902736463 1:18404638-18404660 TTGGACTGTGCTCAGCTGGAAGG + Intergenic
903974407 1:27139769-27139791 GTGTGCTTAGCTCACATAGAGGG - Intronic
905516536 1:38566025-38566047 TTATGCTGTGTTCAAATGCATGG + Intergenic
905609578 1:39338579-39338601 TTGTGCTGTGCTCTAACGAAAGG + Intronic
906269186 1:44460942-44460964 TTGAGATGTGCTGACAGGGAAGG - Intronic
906665228 1:47616710-47616732 TTGTGCTGGAATCACATGGCAGG + Intergenic
906791136 1:48659638-48659660 CTGAGCTCTGCTCACCTGGAGGG - Intronic
907370739 1:54001750-54001772 TTTTGCTGTGCAAACATGCAGGG - Intergenic
908530092 1:65026129-65026151 TTGGGGTGGGATCACATGGAAGG - Intergenic
909677234 1:78252213-78252235 TTGTGCCCTGCTCACCTGGAAGG + Intergenic
911390363 1:97233502-97233524 TTGTCCTTTGCTTGCATGGATGG + Intronic
912624546 1:111196502-111196524 TTGTGCAGTGCTCCTAGGGATGG - Intronic
913184596 1:116357833-116357855 TTGTGCTGTTCTCTGATTGATGG + Intergenic
913998772 1:143674773-143674795 ATGTTCTTTGCTCCCATGGAAGG - Intergenic
915664117 1:157429381-157429403 TTGTTCTGTGCACAGATGGGTGG + Intergenic
919469043 1:197956223-197956245 TGGTGCTGTCCCCAGATGGAAGG - Intergenic
921668719 1:217903099-217903121 TTTTATTGTGCTCACATGTAAGG - Intergenic
922303020 1:224319934-224319956 TTCTGCTGTTTTCACATGGTTGG - Intronic
923308010 1:232706088-232706110 TAGTGCTGTTCTAACATAGAGGG - Intergenic
1063090340 10:2860313-2860335 TTGGGCTGGGCTCAGCTGGATGG + Intergenic
1065232014 10:23608055-23608077 TTGTGCTGTCCTCATAAGGGTGG - Intergenic
1065761116 10:28984180-28984202 TTGGGCTGGGCTCAGAAGGATGG + Intergenic
1065876053 10:29998270-29998292 TTGTGTTGTGTGCACATGTATGG - Intergenic
1068780817 10:60917548-60917570 TTGTGGTGTCCTCACATGACAGG + Intronic
1069324192 10:67210890-67210912 TTTTGCAGTGCTCACAAGTATGG + Intronic
1070745215 10:78929651-78929673 TTGTGCAGAGCTCAAAAGGATGG + Intergenic
1071043275 10:81340134-81340156 TTGTCCTCTGCCCAAATGGATGG + Intergenic
1075078482 10:119367520-119367542 TTGGGGTGTGGTCACATGGTTGG + Intronic
1075667064 10:124239253-124239275 TTGAGATGTGATCAAATGGATGG + Intergenic
1076528137 10:131125699-131125721 CTCTGCTCTGCTCACGTGGATGG + Intronic
1076567191 10:131406907-131406929 TGGTGCTCTGCTCCCAAGGACGG - Intergenic
1076608770 10:131707271-131707293 TTGGGCTGGGCTCAGTTGGATGG - Intergenic
1076874537 10:133209632-133209654 GAGTGCTGTGCTTCCATGGAAGG + Intronic
1076942812 10:133621145-133621167 TTGTGCTGTCCTCCCTTGGAGGG - Intergenic
1080281514 11:30562783-30562805 TTGTGCTGTACTCACTGTGAAGG - Intronic
1080575401 11:33594349-33594371 TTGGGCTGAGCTCAGCTGGATGG + Intronic
1081879483 11:46435949-46435971 TTGTTCTATGCTCACATCAAGGG - Intronic
1087476036 11:98636433-98636455 TTGTGCTATGCTCACATGACTGG + Intergenic
1087703171 11:101460259-101460281 TTTTGGTGTGCTCAGAAGGAGGG - Intronic
1088445940 11:109928621-109928643 ATGTGCAGAGATCACATGGAGGG - Intergenic
1088609491 11:111563695-111563717 GTGTGCTGAGCTTAGATGGAAGG - Intergenic
1088710317 11:112502110-112502132 TTGTTGTGTCCTCACATGGCAGG + Intergenic
1088991729 11:114959959-114959981 CTCTGCTGAGCTCACCTGGAAGG + Intergenic
1090392798 11:126400337-126400359 TGGGGCTCTGCTCTCATGGATGG - Intronic
1090746609 11:129710555-129710577 TTGTGCTGTGCTCAGATCACAGG + Intergenic
1091786676 12:3247067-3247089 ACGTACTGTGCACACATGGAAGG + Intronic
1091843934 12:3640776-3640798 ATGTGCTGTGTCCACATAGATGG - Intronic
1092146767 12:6220031-6220053 TTGTGCTCTGCTGAGATGGGAGG + Intronic
1094642213 12:32287507-32287529 TTGGGCTGTGCTCAGCTGGGTGG + Intronic
1095245584 12:39917399-39917421 GTGTGATGTGCTGACTTGGATGG + Intronic
1096325902 12:50661658-50661680 TTGTGCTGTACTAATGTGGAAGG - Intronic
1100794461 12:98165478-98165500 TTGTTATGTGATCACCTGGATGG - Intergenic
1104143484 12:126010157-126010179 TTGGGCTGTGCTCAGAAGAAGGG - Intergenic
1105947794 13:25204286-25204308 ATGTGCTGTGCACATATGGATGG - Intergenic
1106385316 13:29279281-29279303 CTGTGCTGTGGTCAAGTGGAAGG + Intronic
1107301281 13:38968370-38968392 TTGTGCAGTTCACACATGGAGGG - Intronic
1107402585 13:40083963-40083985 TTGTCCTGTGCTAGCATAGAAGG + Intergenic
1117248551 14:53912046-53912068 TTGTTCTGGGCTCAAATGGCAGG - Intergenic
1117434090 14:55699823-55699845 TTGGCATGTGCTCACAGGGAGGG - Intronic
1117794224 14:59375130-59375152 TGGTGGTGTGCTCATATGAATGG - Intergenic
1123112100 14:105877287-105877309 TTGGGCAGAGGTCACATGGAAGG - Intergenic
1127931266 15:63599064-63599086 TTGAGCTGGGGTCACATGGTTGG - Intronic
1128372440 15:67050172-67050194 TTGAGCTCAGCCCACATGGATGG - Intergenic
1130956720 15:88632031-88632053 CTGTGCTGTGCTGACAGGGAGGG - Exonic
1131033357 15:89204952-89204974 CTGTTCTCTGCTCACATGCAAGG + Intergenic
1131762822 15:95642700-95642722 TTGCGGTGTCCTCACATGGTGGG + Intergenic
1132233790 15:100204005-100204027 CTGTGTTGTGCTGGCATGGATGG - Intronic
1140040272 16:71402972-71402994 TTGTGCTGTACTCACACCCAGGG + Intergenic
1141089926 16:81123228-81123250 TTGTGCTGTGCACTGATGTATGG + Intergenic
1141725723 16:85787169-85787191 TGGGGCCGTGCCCACATGGAGGG - Intronic
1141979312 16:87540190-87540212 CTGTTCTGTGTCCACATGGATGG + Intergenic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152326132 17:79638793-79638815 TTGTGCAGAGATCACATGGCAGG - Intergenic
1157542873 18:48524688-48524710 TGGTGCAGGGCTCACATGGATGG - Intergenic
1160359094 18:78255537-78255559 ATGTGCAGAGATCACATGGAGGG + Intergenic
1163821979 19:19501156-19501178 TTGCACTGTGCACACATGTAGGG - Exonic
1164171541 19:22729736-22729758 GTGGGCTGTGTTCACGTGGAAGG - Intergenic
1166138543 19:40792402-40792424 TTGGGCTGAGCTCAAATGAATGG + Intronic
1166977168 19:46611439-46611461 TGGTCCTGAGCTCACAGGGAGGG + Intergenic
925661231 2:6205050-6205072 TTGAGGTGTCCTCACATGGTGGG + Intergenic
926579737 2:14622176-14622198 TTGCCGTGTGCTCACATGGTTGG - Intergenic
927191284 2:20518841-20518863 TTGCTGTGTCCTCACATGGAAGG - Intergenic
927838347 2:26420026-26420048 TAGTCCAGGGCTCACATGGATGG + Intronic
927882721 2:26699975-26699997 GCTAGCTGTGCTCACATGGAAGG - Intronic
928272186 2:29866342-29866364 TGCTGCTGTGCAAACATGGATGG - Intronic
928816460 2:35300806-35300828 TTGAACTGTGCTGACATTGATGG + Intergenic
929638741 2:43553456-43553478 TTGCTGTGTGCTCACATGGCAGG - Intronic
931899731 2:66774400-66774422 TTGTTCTGTTCTCACTTGTAAGG - Intergenic
933821027 2:86112251-86112273 TTTCGCTGTGCTCACCAGGATGG + Intronic
934656227 2:96117934-96117956 ACGTGCTCTGCTCCCATGGAGGG - Intergenic
935226277 2:101055717-101055739 TTGTGGTGAGCTCCCAGGGATGG - Intronic
935536502 2:104300595-104300617 TTGTGCTGTGCTGCCTTGGAGGG - Intergenic
937554529 2:123136932-123136954 TTATGTGCTGCTCACATGGAAGG + Intergenic
940378281 2:152983205-152983227 TTGTGGTGTGCCCACACAGAAGG + Intergenic
942568423 2:177289444-177289466 TTGTGATGTCCTCACATAGATGG + Intronic
943122816 2:183758232-183758254 TTGTGCTGTGCACACCTGTATGG - Intergenic
944112820 2:196152430-196152452 TTGTGTGCTGCTCATATGGAAGG + Intronic
945601600 2:211873160-211873182 ATCTGCTGTGCTGAAATGGAAGG - Intronic
945751125 2:213784126-213784148 ATCTGCTGTGCTGAAATGGAAGG + Intronic
947360664 2:229342292-229342314 ATGTGCTGTGCTCACTCAGATGG - Intergenic
948450547 2:238067918-238067940 TTTTGCTGTGCTCACATTAAGGG + Intronic
948522278 2:238547554-238547576 TAGTGCAGTGCTCACATGTCAGG + Intergenic
948522656 2:238550286-238550308 TGGTGCAGTGCTCACATGTCAGG + Intergenic
948877936 2:240840101-240840123 GCGTGCTGTGCTCCCTTGGATGG - Intergenic
1168874641 20:1163014-1163036 TTGTGCTATGGTCTCATGCAAGG + Intronic
1169236193 20:3931809-3931831 TTGTGCTCTCCTCTCATGGCTGG + Exonic
1172197557 20:33102450-33102472 TTGTGCTGTTCTGAGATGGGAGG - Intronic
1173644384 20:44624413-44624435 TTGTGCTGGCCTCCCATGGGGGG - Intronic
1175637336 20:60596832-60596854 TGGGGCTGTGCTGGCATGGATGG - Intergenic
1175832885 20:61976665-61976687 TCCAGCTGTGGTCACATGGAGGG - Intronic
1175896171 20:62336408-62336430 ATGTGCCGGGCTCACGTGGAGGG - Exonic
1177676725 21:24309932-24309954 ATGTGCAGAGATCACATGGATGG + Intergenic
1178752830 21:35320703-35320725 TTCTGCTGGGCCCACTTGGAAGG + Intronic
1178757829 21:35369253-35369275 TGGTGCTGTCATCCCATGGAGGG - Intronic
1179362599 21:40726664-40726686 TTGTGCTGCGTCCACTTGGAAGG - Intronic
1179585653 21:42372592-42372614 TTGTGCTGGAATCAGATGGAAGG + Exonic
1179611286 21:42552946-42552968 TTGTTTTGTGCTCAGAGGGAGGG - Intronic
1181315564 22:21968831-21968853 TTGGGCTGGACTCACATGGGTGG - Intronic
1182463992 22:30503188-30503210 TTGTGCTGTGCTCATACACAGGG + Intronic
1184884429 22:47333685-47333707 TTGTGCTGGGCTCAGCTGGGAGG + Intergenic
949866616 3:8552621-8552643 TTCTGTTGAGCTCACATGTAAGG - Intronic
950440286 3:13006444-13006466 TTGTGGTGGGGGCACATGGAGGG + Intronic
950484885 3:13267179-13267201 TCTTGCTGTCCTCACATGGTTGG - Intergenic
951897534 3:27624506-27624528 TATTGCTGTTCTCACAAGGAAGG + Intergenic
952863309 3:37832931-37832953 TTGTCCTTTGCTTAGATGGATGG - Intergenic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
956698045 3:71935324-71935346 TTTTGCTGTGATTACCTGGAGGG - Intergenic
957126337 3:76166153-76166175 TTGTGCTTTTCACACATTGAAGG - Intronic
960592387 3:119378619-119378641 TTCTGCTGTGCACACAGGGAGGG - Intronic
960944105 3:122954237-122954259 TTGTCCTCAGCTCACATGGCAGG - Intronic
961572728 3:127811916-127811938 TAGTGCTGGGCTCAGCTGGATGG - Intronic
963591582 3:147267428-147267450 TTGTGCTGGGCTGGCAGGGAAGG - Intergenic
963872927 3:150438269-150438291 TTGTGATGCCCTCACATGGTTGG + Intronic
964320994 3:155497144-155497166 TAGTGTTGAGTTCACATGGAGGG - Intronic
965250784 3:166341948-166341970 TTCTCCTGTCCTCAAATGGAAGG - Intergenic
966505261 3:180693562-180693584 TTGTGCTGTGCTCACATGGATGG - Intronic
967088948 3:186118902-186118924 TTCTGCCTTGCTCACATGGTGGG + Intronic
968295949 3:197576824-197576846 TTGGGCTGTGAGCACCTGGATGG - Intergenic
973971194 4:56215347-56215369 TAGGGCAGTGCTCTCATGGATGG - Intronic
977776736 4:100929829-100929851 ATGTGCTGTGCCCTCATGAATGG + Intergenic
978678923 4:111354376-111354398 TTGTTGTGTCCTCACATGGCAGG - Intergenic
981436526 4:144729933-144729955 TTCTGCAGTGCTCATTTGGAAGG + Intronic
982502490 4:156174183-156174205 TCTTGCTGTGGTCACATGGGGGG + Intergenic
982956646 4:161777725-161777747 TTGTGCTGTTATTACATGGCAGG - Intronic
985675027 5:1226491-1226513 TTGTGCGGGGCTCTCAGGGAAGG - Intronic
989513402 5:42314772-42314794 TTGCTCTGTCCTCACATGGCAGG - Intergenic
990091260 5:52052697-52052719 TTGCTGTGTTCTCACATGGAAGG + Intronic
991084785 5:62638709-62638731 TTGTTCTGTTCTCACATGGTGGG - Intergenic
995754828 5:115491654-115491676 TTGTCCTGTGATCTTATGGATGG - Intergenic
997708288 5:135979548-135979570 TTGTGATGTGCTAACTTGGATGG - Intergenic
997771758 5:136561531-136561553 TTGTTCTATGCTTACATAGATGG - Intergenic
1001487631 5:172130784-172130806 TTGTGCTGTTCTTTCATGTAAGG - Intronic
1001994481 5:176144786-176144808 CTGTGCTGTGGTCACATGTCAGG + Intergenic
1002269107 5:178058082-178058104 TTGTGCTGCCCTCCCTTGGAGGG + Intergenic
1003680898 6:8255219-8255241 GTGTGCTTTGCTCACAGGCATGG + Intergenic
1003796702 6:9613267-9613289 TGGTGCTGTGTGCACAGGGAGGG - Intronic
1004794738 6:19068663-19068685 TTGTTGTGTCCTCACATGGTGGG + Intergenic
1005403286 6:25457866-25457888 TTGTGCTTTTCTCACATTGCAGG + Intronic
1011596573 6:89022275-89022297 TTTTGCTGTGTTCTCATGGATGG - Intergenic
1012742586 6:103037186-103037208 TTGTAATGTGCTCACTTGGGTGG + Intergenic
1014657545 6:124127180-124127202 TTGAGCTGTGCATTCATGGATGG + Intronic
1015097438 6:129432396-129432418 TTGTCCTCTACTCACATGGTGGG - Intronic
1015478746 6:133683076-133683098 TTTTGTTTTGCTCACATGAAGGG + Intergenic
1016403792 6:143709024-143709046 TTGTGCTGAACTCTCATGGAAGG - Intronic
1017630589 6:156392785-156392807 GTGTGGTGTGCCCACCTGGAGGG - Intergenic
1018614609 6:165674954-165674976 GTGTGCTGTGGGCACCTGGATGG - Intronic
1019885185 7:3897982-3898004 GTGTACTGTGCACACATGGAAGG - Intronic
1020444255 7:8252314-8252336 ATGTTCTGTGCTGACATCGAAGG - Intronic
1020462120 7:8437506-8437528 TTGGGCTGTGCTCACACACACGG + Intronic
1020713360 7:11636880-11636902 GTGTGGTGTGCTCATGTGGAGGG - Exonic
1022200372 7:28110785-28110807 TGGTGATGTGCCCACATGGCTGG + Intronic
1023926142 7:44671225-44671247 TTGTGCAGAGATCACATGGTGGG + Intronic
1024694530 7:51841186-51841208 TTGTGCGGAGATCACATGGAGGG + Intergenic
1024812180 7:53225065-53225087 TTGTGTTGTGATTACCTGGATGG + Intergenic
1026661398 7:72305863-72305885 TTGCTCTGTCCTCACATGGTCGG + Intronic
1026896732 7:74013776-74013798 GGGGGCTGTGCTCACCTGGAGGG - Intergenic
1027571088 7:79868176-79868198 TTGAGCTGGGCTCACACTGAAGG + Intergenic
1031147045 7:118008110-118008132 TTGCTGTGTGCTCACATGGCTGG + Intergenic
1033352203 7:140570621-140570643 GTGTTCTGTGAACACATGGAGGG - Intronic
1033393836 7:140955174-140955196 TAGTGCTGTTTTCACATCGAAGG + Intergenic
1034424453 7:151007269-151007291 CTGGGCTGGGCTCACCTGGAAGG - Exonic
1037714449 8:21385185-21385207 TTGCTGTGTCCTCACATGGAGGG + Intergenic
1040530009 8:48259072-48259094 TTGGGCTGAGCTCAGCTGGATGG - Intergenic
1041169090 8:55122853-55122875 GTTTACTGTGGTCACATGGAGGG + Intronic
1042537307 8:69871464-69871486 ATGAGCTCTGCTCACAAGGATGG - Intergenic
1043864862 8:85363257-85363279 TTGTGCTGTGCTCCTGTGAATGG - Intronic
1044964925 8:97565488-97565510 TTATTCTGTCCTCACATGGCCGG + Intergenic
1046353096 8:113041405-113041427 TTGTGCTGCCCTCACATTGGGGG + Intronic
1047438886 8:124858775-124858797 TTGTGCTGTGGTCACAGGCCTGG - Intergenic
1048367926 8:133754619-133754641 TTGTGCCGTGCTTACAGGGTGGG + Intergenic
1051150137 9:14071296-14071318 TTGTGCTGTTCTCCCCCGGATGG - Intergenic
1055806904 9:80105866-80105888 TTTTTCTATGTTCACATGGAAGG - Intergenic
1056005941 9:82271439-82271461 ATGTGCTTTGCTTGCATGGATGG + Intergenic
1057878763 9:98777487-98777509 TTATGCTGTGGACACGTGGAGGG - Intronic
1059206435 9:112471416-112471438 TTGTTCTGTGCACACATTGCTGG - Exonic
1186530121 X:10286887-10286909 TTGGGCAGGGCTCAGATGGATGG + Intergenic
1186720903 X:12302536-12302558 TAGTCCTGAGCTCACTTGGATGG + Intronic
1187695079 X:21911608-21911630 ATGTGATGAGCTCACATGCAGGG - Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1190481376 X:50880463-50880485 TTGTTATGTCCTCACATGGTGGG + Intergenic
1192557820 X:72104536-72104558 ATGTGTTCTGCTCACATTGAGGG + Intergenic
1193005001 X:76606578-76606600 CTCTGCTTTTCTCACATGGAAGG - Intergenic
1195264491 X:103166600-103166622 TTGTACATTGCTCACAGGGATGG - Intergenic
1196291525 X:113947289-113947311 TAGCTCTGTCCTCACATGGATGG - Intergenic
1198114020 X:133527456-133527478 CTGTGCTGTTCTCTCAGGGAAGG - Intergenic
1201388258 Y:13467314-13467336 TTGTGCTTTGGGCACATGGTGGG - Intronic