ID: 966508167

View in Genome Browser
Species Human (GRCh38)
Location 3:180730620-180730642
Sequence TTCCCATGCTGTTCTCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 809
Summary {0: 3, 1: 15, 2: 121, 3: 194, 4: 476}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966508167_966508173 13 Left 966508167 3:180730620-180730642 CCACCACGAGAACAGCATGGGAA 0: 3
1: 15
2: 121
3: 194
4: 476
Right 966508173 3:180730656-180730678 TGATTCAATTACCTCCCACCAGG 0: 1557
1: 4669
2: 8676
3: 9631
4: 7761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966508167 Original CRISPR TTCCCATGCTGTTCTCGTGG TGG (reversed) Intronic
900159959 1:1218808-1218830 TTCCCCGGCTGTGCTCGGGGTGG + Exonic
900847299 1:5114184-5114206 CCCCCATACTGTTCTCATGGTGG - Intergenic
900847994 1:5118933-5118955 CCCCCATACTGTTCTCGTGGTGG - Intergenic
901365196 1:8741507-8741529 CTCCCATGCTGTTCTCGTGATGG + Intronic
901808811 1:11754244-11754266 TCCCCATACTGTTCTGGTGATGG - Intronic
902090236 1:13897294-13897316 TTCCTATGCTGGTCTAGGGGAGG - Intergenic
902125836 1:14210190-14210212 TTCCCATGCTGTTCTTGTGATGG + Intergenic
902273426 1:15323048-15323070 TTCCCGTGCTGTTCTCCTGATGG - Intronic
902793620 1:18785814-18785836 CTCCTATGCTGTTCTCATGATGG - Intergenic
904358352 1:29956110-29956132 TTCCCATGTTGTTCTTGTGATGG + Intergenic
905415252 1:37799591-37799613 TGCCCATGCTGTTCTTATAGCGG - Exonic
905525963 1:38639827-38639849 CTCCCTTGCTGTTCTCGTGATGG - Intergenic
905900256 1:41576677-41576699 GCCCCATGCTGTCCTTGTGGGGG - Intronic
906968608 1:50485923-50485945 TCCCCTTGCTGTTCTCATGATGG - Intronic
907539472 1:55200028-55200050 TCCCCATATTGTTCTCGTGGTGG - Intronic
908032983 1:60020968-60020990 CCCCCATGCTGTTCTTGTGATGG + Intronic
908603424 1:65765925-65765947 CCCCCATGCTGTTCTCGTGATGG - Intergenic
908809862 1:67969558-67969580 TTCTCATGCTGTTCTCGTGATGG - Intergenic
909024225 1:70464129-70464151 TCCCCATGCTATTCTCATGATGG - Intergenic
909066457 1:70940672-70940694 TTCCCATGCTATTCTCATGATGG - Intronic
909298798 1:73984498-73984520 CCCCCATACTGTTCTCATGGTGG - Intergenic
909360666 1:74755941-74755963 TTCCTGTGCTGTTCTTGTGATGG + Intronic
909941010 1:81611862-81611884 CCCCTATGCTGTTCTCGTGCTGG + Intronic
911417180 1:97589365-97589387 CCCCCATGCTGTTCTCATGATGG + Intronic
911535114 1:99090270-99090292 TTCCCATGCTCTTCTCATGATGG + Intergenic
911600217 1:99840460-99840482 TTTCCCTGCTGTTCACGTGTTGG + Intergenic
911667125 1:100565616-100565638 CCCCCATGCTGTTCTCATGAGGG + Intergenic
911907587 1:103589420-103589442 TTCCCATGCTGTTCTGTTCTCGG - Intergenic
912006322 1:104905135-104905157 TTCCCATGCTATTCTCATGATGG - Intergenic
912135391 1:106655428-106655450 TTCCTGTGCTCTTCTCGTGATGG - Intergenic
912433357 1:109641467-109641489 TTCCCATCCTGCTCTGGTGTGGG + Intergenic
913226632 1:116706161-116706183 CCCCCATACTGTTCTCATGGTGG + Intronic
913256735 1:116960817-116960839 TTCCGATACTGTTCCAGTGGGGG + Intronic
913265219 1:117036641-117036663 TTCCCATGCTGTGCTCTGGCCGG - Intergenic
913402665 1:118454010-118454032 TTCCCATGCTGTTCCTGTGATGG - Intergenic
914386629 1:147175483-147175505 CCCCCATGCTGTTCTTGTGATGG + Intronic
915766353 1:158366226-158366248 TTCCCATGCTGTTCTCATGATGG + Intergenic
916579052 1:166091371-166091393 TTCTCTTGCTGTTCTCATGATGG + Intronic
916777678 1:167985063-167985085 TTCCCATGCTGTTCTTGTGATGG - Intronic
917022086 1:170601011-170601033 TTCCTGTGCTGTTCTTGTGATGG - Intergenic
917090251 1:171345957-171345979 TTCCCATGCTGTTCTCATGATGG + Intergenic
917861242 1:179146656-179146678 CCCCCATGCTGTTCTCGTGATGG + Intronic
917867590 1:179212164-179212186 CTCCCATGCTGTTCTCCTGATGG - Intronic
918023400 1:180717376-180717398 CTGTCATGCTGTTCTTGTGGAGG + Intronic
918060312 1:181055653-181055675 TTCACATGGTGTTCAAGTGGAGG - Exonic
918531308 1:185525146-185525168 TTCCCATGCTGTTCTCATGATGG - Intergenic
918718018 1:187817286-187817308 TTCCCATGCTCCTCTCATGGTGG - Intergenic
918736099 1:188065556-188065578 TCCCCATACTGTTCTCATGATGG + Intergenic
918931547 1:190861607-190861629 TTCCCGTACTGTTCTCATGATGG - Intergenic
918975994 1:191487515-191487537 TTCCTGTGCTGTTCTCATGATGG + Intergenic
919065891 1:192692784-192692806 TTTCTGTGCTGTTCTCGTGATGG - Intergenic
919141950 1:193583549-193583571 TTCCTGTGCTGTTCTCTTGATGG - Intergenic
919272126 1:195361059-195361081 CCCTCATGCTGTTCTCGTAGTGG - Intergenic
920179378 1:204123037-204123059 TCCCCATGCTCCTCTCTTGGTGG - Intronic
921594204 1:217037476-217037498 TTCCCGTGCTGTTCTTCTGACGG - Intronic
921694696 1:218194658-218194680 TTCTCATGCTGTTTTCATGATGG + Intergenic
922669336 1:227496980-227497002 TTCCCATGCTGTTCTTGTGACGG + Intergenic
922670256 1:227504322-227504344 TTCCCATGCTGTTCTTGTGACGG - Intergenic
922683352 1:227619058-227619080 CCCCCATGCTGTTCTTGTGATGG - Intronic
923109199 1:230877413-230877435 TTCCCGTGCTGTACTGGTGTCGG - Intergenic
923447179 1:234082804-234082826 CCCCCATACTGTTCTCCTGGTGG - Intronic
923559531 1:235028087-235028109 TCCACATGCTAGTCTCGTGGGGG - Intergenic
923687230 1:236161671-236161693 TTCCCATGCTATTCTTGTGATGG + Intronic
923935980 1:238760858-238760880 CCCCCATACTGTTCTCGTGGTGG - Intergenic
923999393 1:239533796-239533818 CTCTCCTGCTGTTCTCGTGATGG - Intronic
1063052997 10:2474181-2474203 TTCCCATGCTGTTCTCGTGATGG - Intergenic
1063223208 10:3990435-3990457 TGCCCATGCTGTTCTTGTGATGG + Intergenic
1063481627 10:6381573-6381595 TTCCCGTGCTGTTCTTGTGATGG - Intergenic
1063521777 10:6747868-6747890 TTCCCATGCTGCTCCCGTGATGG + Intergenic
1063608554 10:7543890-7543912 CACCCATACTGTTCTTGTGGTGG - Intergenic
1063892342 10:10643323-10643345 TTCTCATGCTGTTCTCTTGGTGG + Intergenic
1064196555 10:13248426-13248448 CCCCCATACCGTTCTCGTGGTGG - Intergenic
1064794077 10:18991541-18991563 TTCCTGTGCTGTTCTTGTGATGG - Intergenic
1064877307 10:20008784-20008806 TTCCCATACTGTTCTCATGATGG + Intronic
1065323760 10:24532689-24532711 TTCCCGTGCTGTTCTCGAGGTGG - Intronic
1065440667 10:25750414-25750436 CCCCCATACTGTTCTTGTGGGGG + Intergenic
1066110295 10:32189600-32189622 TTCCCATGCTGTTCACTTTTTGG + Intergenic
1066426771 10:35314406-35314428 ACCCCATACTGTTCTCTTGGTGG - Intronic
1068290065 10:54989911-54989933 TTCCCATGCTGTTCTCATGATGG + Intronic
1068352057 10:55861006-55861028 TCCCCATGTTGTTCTCCTGTTGG + Intergenic
1068405975 10:56589182-56589204 TTCCCATGCTGTTCTCATGAAGG - Intergenic
1069086274 10:64143287-64143309 TTGCCCTTCTGTTCCCGTGGTGG + Intergenic
1069114569 10:64489210-64489232 CTCCCTTGCTGTTCTCATGATGG - Intergenic
1069224487 10:65924941-65924963 TTCCCATGATGTTCTCATGATGG - Intronic
1069789584 10:71011159-71011181 CCCCCATGCTGTTCTTGTGATGG - Intergenic
1070428753 10:76315662-76315684 TGCCCAGGCTGTTCACGTTGAGG - Intronic
1071664204 10:87538009-87538031 TGCCCAGGCTGGTCTCCTGGTGG + Intronic
1071674711 10:87644612-87644634 TTCCCATGTTGTTCTTGTGGTGG + Intergenic
1071818145 10:89253440-89253462 AGCCCATACTGTTCTTGTGGTGG - Intronic
1071893927 10:90043372-90043394 TTCCCATGCTGTTCTCATGATGG + Intergenic
1071987956 10:91071946-91071968 TTCCCATACTGTTCTTATAGTGG + Intergenic
1072050008 10:91693959-91693981 TTCCTGTGCTGTTCTTGTGACGG - Intergenic
1072538881 10:96383423-96383445 CCCCCATACTGTTCTTGTGGTGG + Intronic
1074286393 10:112101852-112101874 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1074900171 10:117809627-117809649 TCCCTGTGCTGTTCTCGTGATGG + Intergenic
1074961285 10:118448270-118448292 TTCCCTTGCTTTCTTCGTGGAGG - Intergenic
1074981530 10:118623804-118623826 CCCCCTTGCTGTTCTCGTGATGG + Intergenic
1075198396 10:120380455-120380477 TTCCCATGCTATTCTTGTAATGG + Intergenic
1075225164 10:120622269-120622291 TCCCCATACTGTTCTCGTGGTGG + Intergenic
1075550207 10:123387183-123387205 TTCCCATGTTGTTCTCATAATGG + Intergenic
1076242599 10:128920978-128921000 CCCCCTTGCTGTTCTCGTGATGG - Intergenic
1076261779 10:129072159-129072181 TTCCCATGCTGTTCTCGTGATGG + Intergenic
1076574149 10:131452931-131452953 TCCCCGTGCTGTTCTCCTGATGG - Intergenic
1076593946 10:131613514-131613536 TTTCCATGCTGTTCTCATGGTGG - Intergenic
1076772275 10:132672437-132672459 TTCCCATGGTGTTCTCATGGTGG + Intronic
1077331453 11:1985629-1985651 ATCCCCTGCAGTTCTGGTGGTGG + Intergenic
1078109205 11:8378577-8378599 TTCTCATGCTGTTCTCGTGATGG - Intergenic
1078892867 11:15573078-15573100 CTCCCTTGCTGTTCTCATGATGG + Intergenic
1078903907 11:15666683-15666705 TTCCCCTTCTGTTCTCAGGGAGG - Intergenic
1079475255 11:20823309-20823331 CGCCCATACTGTTCTAGTGGTGG - Intronic
1079562861 11:21844478-21844500 TTCCCATGGTGTTCTCATGGTGG + Intergenic
1079721127 11:23816163-23816185 TTCCTATGCTGTTCTCATGATGG - Intergenic
1079732320 11:23950172-23950194 CCCCCATGCTGTTCTCATGATGG - Intergenic
1079763641 11:24361403-24361425 TTCCTAAGCTGTTCTCATGAGGG + Intergenic
1080000401 11:27341920-27341942 TTCCCATGCTGTTCTCATGATGG + Intronic
1080205035 11:29718300-29718322 TTCCCATTCTGTTCTTGTGATGG - Intergenic
1080215316 11:29832995-29833017 TTCTCATGCTGTTCTTTTGATGG + Intergenic
1080606232 11:33867155-33867177 TTCCCTTGCTGTGCTACTGGTGG - Intronic
1080619028 11:33971208-33971230 TTCTCATGCTGTCCTCCAGGTGG - Intergenic
1080922830 11:36726029-36726051 TTCCCATGCTGTTCTCATGATGG - Intergenic
1081305569 11:41508032-41508054 TTCCCATACTGTTCTCCTGATGG + Intergenic
1081431290 11:42979215-42979237 TTCCTGTGCTGTTCTTGTGATGG + Intergenic
1081442249 11:43093264-43093286 CCCCCATGCTGGTCTCGTGGTGG + Intergenic
1081749446 11:45499435-45499457 TTCCCATGCCTTTCTGATGGTGG + Intergenic
1082049784 11:47761705-47761727 TGCCCAGGCTGTTCTCAAGGAGG - Intronic
1082194638 11:49287648-49287670 TCCCCATGCCGTTCTCATGATGG - Intergenic
1082242849 11:49889742-49889764 GTCCCATGCTGTTCTGGAGTGGG - Intergenic
1082864269 11:57884334-57884356 CCCCCATGCTGTTCTCATGATGG + Intergenic
1083004190 11:59326018-59326040 TTCCCATGCTATTCTCATGATGG - Intergenic
1085875609 11:80403600-80403622 TTCCTGTGCTGTTCTCATGATGG + Intergenic
1085906975 11:80775215-80775237 TTTCCATGCTGTTCTCCTGTTGG + Intergenic
1086047413 11:82549065-82549087 TTCCTATGCTGTTCTCATGATGG - Intergenic
1086180290 11:83942970-83942992 TTCCTATGCTGTTCTCATGATGG + Intronic
1086392220 11:86376562-86376584 CCCCCATGCTGTTCTCATGATGG - Intronic
1086419033 11:86619541-86619563 CCCCCATACTGTTCTAGTGGTGG + Intronic
1086529967 11:87773306-87773328 TACCCATGGTGTTTTCGTAGAGG + Intergenic
1087255241 11:95945746-95945768 CCCCCATGCTGTTCTCATGCTGG + Intergenic
1087496392 11:98895132-98895154 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1087570581 11:99922248-99922270 TTCCCATTGTGTTCTCATGATGG - Intronic
1087644050 11:100786929-100786951 TCCTCATGCTGTTCTTGTGTTGG + Intronic
1088421662 11:109655302-109655324 TTCCTGTGCTGTTCTTGTGATGG - Intergenic
1088531589 11:110816507-110816529 TCCCCATTCTGTTCTCATGGTGG + Intergenic
1088601044 11:111475969-111475991 CCCCCATACTGTTCTTGTGGTGG - Intronic
1089667575 11:120030187-120030209 CCCCCATGCTGTTCTCTTGACGG - Intergenic
1091178059 11:133579447-133579469 TGCCCCTGCTGTGCTCGGGGAGG + Intergenic
1202814434 11_KI270721v1_random:40805-40827 ATCCCCTGCAGTTCTGGTGGTGG + Intergenic
1092558921 12:9588871-9588893 ATCCCAGGCTGTTCACATGGTGG - Intergenic
1092724632 12:11473391-11473413 TTCCCATGCTATTCTCATCATGG + Intronic
1093195876 12:16129097-16129119 TTCCCATGCTGTTCGCATGATGG + Intergenic
1093350888 12:18102402-18102424 TCCCTATGCTGTTCTCGTGAGGG - Intronic
1093478632 12:19582331-19582353 TCCCCATGCTGTTCTCATGATGG + Intronic
1094229201 12:28083514-28083536 TCCCCATGCTGTTCTCCTGATGG - Intergenic
1094569109 12:31626448-31626470 CCCCCATACTGTTCTTGTGGTGG - Intergenic
1094785469 12:33843588-33843610 TTTCCATGCTGTTCTCATGAAGG - Intergenic
1095510999 12:42951858-42951880 TCCCCATACTGTTTTCGTGGTGG + Intergenic
1096717112 12:53498331-53498353 TTCCCTTGCAGTTCTCAAGGTGG - Intronic
1098203840 12:68084995-68085017 TTTCCATGCTGTTCTCGTGTTGG - Intergenic
1098636335 12:72788722-72788744 TTCCCACACTGTTCTTGTGATGG + Intergenic
1098686080 12:73423665-73423687 TCCCCATAGTGTTCTCATGGTGG - Intergenic
1098953942 12:76669359-76669381 TTCCCGTGCTGTTCTCCTGATGG + Intergenic
1099008083 12:77259487-77259509 TTCCTGTGCTGTTCTCATGATGG - Intergenic
1099088764 12:78279172-78279194 TTCTCATGCTGCTCTTGTGATGG + Intergenic
1099466874 12:82999700-82999722 TTCCCATGCTGTTCTCGTGATGG - Intronic
1099557553 12:84128725-84128747 TTCCCAGGCTGTTCCCGCTGAGG - Intergenic
1099700535 12:86076713-86076735 TTTCCATGCTATTCTCATGATGG - Intronic
1099905006 12:88761287-88761309 TCCCCATGCTGTTCTCATGACGG - Intergenic
1100118182 12:91335175-91335197 TTCCCATGCTGTTCTGGTGATGG - Intergenic
1100787791 12:98096877-98096899 TTCCCATGCTTTTCTCATGATGG + Intergenic
1101202526 12:102451866-102451888 CCCCCATGCTGTTCTCATGATGG + Intronic
1101696566 12:107132731-107132753 CCCCCATACTGTTCTCATGGTGG + Intergenic
1103485241 12:121278559-121278581 CCCCCATACTGTTCTCATGGTGG + Intronic
1103987127 12:124774995-124775017 ACCCCATACTGTTCTCCTGGTGG + Intergenic
1104353539 12:128065734-128065756 TTCCTGTGCTGTTCTCATGATGG + Intergenic
1104534177 12:129602973-129602995 CTCTCATGCTGTTCTCGTGATGG - Intronic
1104552398 12:129769401-129769423 TTCCCATACTGTTCTTGTGGTGG - Intronic
1104656912 12:130580332-130580354 CCCCCATGCTGTTCTCATGGTGG + Intronic
1106311841 13:28561475-28561497 GTCCCATGCTGTTCTCATGGTGG + Intergenic
1106395682 13:29378949-29378971 CCCCCATGCTGTTCTCATGATGG + Intronic
1107199438 13:37696198-37696220 TTCCCATGCTGTTTTCATGATGG - Intronic
1108140057 13:47411105-47411127 TCCCCATGCTCTTCTCATGATGG + Intergenic
1108513540 13:51175849-51175871 TCCCCTTGCTGTTCTCATGATGG + Intergenic
1108586959 13:51878482-51878504 CCCCCATGCTGTTCTTGTGATGG - Intergenic
1108609527 13:52070476-52070498 TTCCCATGCTGTTCTCGTGATGG + Intronic
1108687336 13:52832183-52832205 CCCCCATGCTGTTCTCATGATGG - Intergenic
1108788969 13:53943232-53943254 CTCCCATACTGTTCTTGTGGTGG - Intergenic
1108860676 13:54854623-54854645 TTCCCTTGCTGGTCTTGTGATGG + Intergenic
1109197748 13:59396912-59396934 TGCCTATGCTGTACTTGTGGAGG - Intergenic
1109333409 13:60960579-60960601 TCCCCATGTTGTTCTCATGACGG + Intergenic
1109337296 13:61008889-61008911 TTCCCATGCTGTTCTCATGATGG + Intergenic
1109345844 13:61113723-61113745 TGCCCAAGCTGTTCATGTGGAGG - Intergenic
1109720952 13:66276207-66276229 TTCTCATGCTGTTCTCATAATGG + Intergenic
1109721203 13:66278139-66278161 TTATCATGCTGTTCTTGTGATGG + Intergenic
1110559893 13:76899482-76899504 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1110605703 13:77429773-77429795 TTCCCATGCTATTCTCATGATGG - Intergenic
1111054612 13:82932530-82932552 TTCCCATGCTGTTCTCCTGTTGG + Intergenic
1111087264 13:83392782-83392804 TTCCCATGCTGTTCTCATGATGG + Intergenic
1111233228 13:85372438-85372460 TTCTCATTCTGTTCTCATGAGGG + Intergenic
1111477600 13:88773265-88773287 TTCCCATGCTGTTTTCATGATGG - Intergenic
1111614449 13:90645028-90645050 TCCACATGCTTTTCTTGTGGTGG - Intergenic
1111621727 13:90732773-90732795 CCCACATGCTGTTCTTGTGGTGG + Intergenic
1111685942 13:91500866-91500888 CCCCCATACTGTTCTCATGGTGG + Intronic
1112183323 13:97106031-97106053 CCCCCATGCTGTTCTCATGATGG - Intergenic
1112254996 13:97821368-97821390 TTGCCATGCTGTTCTCATGGTGG + Intergenic
1112498854 13:99926799-99926821 CTCCCATGGTGAGCTCGTGGGGG - Intergenic
1112562448 13:100526431-100526453 TTCCTCTGCTGTTCAGGTGGTGG - Intronic
1112626168 13:101106632-101106654 CCCCCATACTGTTCTTGTGGTGG + Intronic
1112645853 13:101330771-101330793 TTCCTGTGCTGTTCTCATGATGG + Intronic
1112799185 13:103092169-103092191 TTCTCTTGGTGTTCTCATGGTGG - Intergenic
1112799463 13:103094087-103094109 TTCCCATGATGTTCTCATGGTGG - Intergenic
1113029254 13:105975869-105975891 CTCCCATATTGTTCTCATGGTGG - Intergenic
1113386215 13:109850827-109850849 TTCCCACGCTGTTCTCGTGATGG - Intergenic
1114746487 14:25153722-25153744 TTCCTGTGCTGTTCTTGTGATGG + Intergenic
1115007009 14:28498407-28498429 TCCCCATACTGTTCTCGTGGTGG - Intergenic
1115113533 14:29853808-29853830 TTCCCATGCTGTTCTCATAATGG + Intronic
1115113807 14:29855755-29855777 TTCCCATGCTATTCTCCTGATGG + Intronic
1115504176 14:34078575-34078597 CCCCCACACTGTTCTCGTGGTGG + Intronic
1115883235 14:37944357-37944379 CCCCCATACTGTTCTCATGGTGG - Intronic
1116559624 14:46361044-46361066 TTCCCATGTTATTCTTGTGATGG - Intergenic
1116603324 14:46956843-46956865 CCCCCTTGCTGTTCTCGTGATGG + Intronic
1116706723 14:48312001-48312023 ATCCTATGCTGTTCTTGTGATGG - Intergenic
1117158500 14:52964306-52964328 TCCCCATGCTGTTCTCGTGATGG + Intergenic
1117395753 14:55307995-55308017 CTCCCATACTGTTCTCCTCGTGG + Intronic
1117761733 14:59036035-59036057 CTCCCATACTGTTCTATTGGTGG - Intergenic
1117886651 14:60371375-60371397 TTCCCATGCTGTTCTTCTGGTGG - Intergenic
1117977494 14:61312731-61312753 TTCCCATGCTGTTCTTGTGATGG - Intronic
1118113942 14:62752722-62752744 CCCCCATGCTGTTCTCATGATGG + Intronic
1120319018 14:82934862-82934884 TTCCAGTGCTGTTCTCGTGATGG + Intergenic
1120860480 14:89250788-89250810 TTCCCATGCTGTTCTTGTGATGG + Intronic
1120863812 14:89278295-89278317 CCCACATACTGTTCTCGTGGTGG - Intronic
1120895749 14:89530426-89530448 TTCCTGTGCTGTTCTGGTGGTGG - Intronic
1121335580 14:93075869-93075891 TCCCCACGCTGTCCCCGTGGAGG - Intronic
1121588145 14:95078171-95078193 CCCCCATGCTGTTCTCATGATGG - Intergenic
1121936778 14:98027225-98027247 TCCCCATGCTGTTCTCATGATGG - Intergenic
1122368609 14:101214503-101214525 CCCCTATACTGTTCTCGTGGTGG - Intergenic
1122595775 14:102890142-102890164 TCCCCACACTGTTCTCGGGGAGG - Intronic
1122762439 14:104039212-104039234 ACCTCATGCTGTTCTCGTGATGG - Intronic
1122832581 14:104407551-104407573 CCCCCATACTGTTCTCGTGTTGG + Intergenic
1125314623 15:38417964-38417986 TCCCCGTGCTGTTCTTGTGATGG + Intergenic
1126378460 15:48020400-48020422 CCCCCATGCTCTTCTCGTGATGG + Intergenic
1126894711 15:53245847-53245869 TCCCCATACTGTTCTCATGGTGG + Intergenic
1127144495 15:56010599-56010621 CCCTCATGCTGTTCTCGTGATGG + Intergenic
1127179133 15:56396705-56396727 TTCCTGTGCTGTTCTTGTGATGG + Intronic
1129408035 15:75332298-75332320 CTCCCATGCTGTTCTCGTGATGG - Intergenic
1130441768 15:83962064-83962086 CCCTCATACTGTTCTCGTGGTGG + Intronic
1130762336 15:86833396-86833418 TTCCCATGCTATTCTCCTGATGG + Intronic
1131693155 15:94847600-94847622 TTCCCATGCTGTTCTCATGTTGG - Intergenic
1131894472 15:97011340-97011362 TTCCCATTGTGTCCTCATGGTGG + Intergenic
1131915471 15:97260652-97260674 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1132122122 15:99184927-99184949 CCCCCATGCTGTTCTCGTGATGG + Intronic
1132423386 15:101693394-101693416 CCCCCATACTGTTCTTGTGGTGG - Intronic
1132566778 16:627207-627229 TTCCCAGGCTGGGCTCCTGGAGG - Intronic
1132595470 16:747083-747105 TCCACATGCTGTTCTCGTGATGG + Intronic
1133693229 16:8236255-8236277 TCCCCATGCTGTTCTCATGATGG - Intergenic
1134204416 16:12225398-12225420 TTCCCATGCTCTTCTCATGATGG + Intronic
1135148354 16:19983458-19983480 TTTTCATGCTGTTCTCATGATGG - Intergenic
1135785598 16:25346229-25346251 CCTCCATGCTGTTCTCGTGATGG - Intergenic
1135933465 16:26759347-26759369 TTCCCATCCTGTTCTCGTGGTGG - Intergenic
1136112492 16:28073421-28073443 TCCTCATACTGTTCTCATGGTGG - Intergenic
1136170748 16:28487726-28487748 GTCCCAGGCTGTGCTCCTGGCGG - Exonic
1137392794 16:48095190-48095212 CCCCCATACTGTTCTCATGGTGG + Intronic
1137414026 16:48255700-48255722 CCCCCATACTGTTCTCTTGGTGG + Intronic
1138157748 16:54721624-54721646 TTCCCTTGCTATTCTCTTGATGG + Intergenic
1138160976 16:54754097-54754119 ACCCCATGCTGTTCTTGTGATGG - Intergenic
1139188327 16:64833295-64833317 TTCCTGTGCTGTTCTTGTGATGG + Intergenic
1139422763 16:66859179-66859201 TTCTGAGGCTGCTCTCGTGGAGG - Intronic
1139776907 16:69322156-69322178 TTCCCGTGCTATTCTCGTGATGG - Intronic
1140172070 16:72616124-72616146 TTCTTGTGCTGTTCTCGTGATGG - Intergenic
1140302550 16:73772411-73772433 TTCCCATGCTGTTCGCGTGATGG - Intergenic
1141263031 16:82471097-82471119 TTCCCATGCAGTTGTCGAAGCGG + Intergenic
1143335758 17:6170458-6170480 TTCCTGTGCTGTTCTCGTGTTGG - Intergenic
1143468408 17:7154746-7154768 TTCCTGTGCTGTTCTCCTGATGG - Intergenic
1143915771 17:10291740-10291762 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1143935702 17:10481948-10481970 TTTCCATGCTGTCCTAGTAGAGG + Intergenic
1144000734 17:11052413-11052435 CCCCCATGCTGTTCTTGTGATGG - Intergenic
1145752966 17:27368359-27368381 CCCCCCTGCTGTTCTGGTGGTGG - Intergenic
1146451793 17:32980743-32980765 TTCCTATGCTGTTTTCATGATGG - Intronic
1147477328 17:40724562-40724584 TCCTCATGCTGTTCTTGTGATGG + Intergenic
1149236629 17:54598657-54598679 CCCCCATACTGTTCTTGTGGTGG + Intergenic
1149392989 17:56210843-56210865 CCCCCATGCTGTTCTTGTGATGG - Intronic
1149448360 17:56731244-56731266 TTCCCGTGCTGTTCTCGTGATGG + Intergenic
1149883666 17:60318388-60318410 ATCCCATGCTGTTCTCTAGATGG - Intronic
1150647660 17:66989672-66989694 TTCCCATGCTGCTCTCCAAGAGG + Intronic
1150851025 17:68703883-68703905 TTCCTGTGCTGTTTTCGTGATGG - Intergenic
1150966324 17:69973272-69973294 CCCCCATGCTGTTCTCATGATGG - Intergenic
1151007836 17:70458673-70458695 TTCCCATGCTGTTCTCGTGATGG - Intergenic
1151129798 17:71884796-71884818 CCCCCATACTGTTCTCATGGAGG + Intergenic
1151397938 17:73836940-73836962 CCCTCATACTGTTCTCGTGGTGG + Intergenic
1151593393 17:75061814-75061836 TTCCCTTGCTGTGCTCGACGGGG + Intronic
1152268441 17:79309729-79309751 CCCCCATGCTGTTCTTGTGATGG + Intronic
1152487616 17:80604790-80604812 TTCCTGTGCTGTTCTCATGATGG - Intronic
1152937238 17:83146552-83146574 TTCCCATGCTGTTCTTACGACGG - Intergenic
1152967268 18:128861-128883 TTCCTGTGCTGTTCTTGTGGGGG - Intergenic
1152967598 18:131052-131074 TTCCTGTGCTGTTCTCATGGTGG - Intergenic
1153376162 18:4382016-4382038 TTCCCGTGCTATTCTTTTGGTGG - Intronic
1153530998 18:6045611-6045633 TTCCTATGCTGTTCTCATGATGG - Intronic
1153783231 18:8512606-8512628 TTCACATGCTGTTCTCATGATGG - Intergenic
1154926385 18:20940997-20941019 TTCCTGTGCTGTTCTCATGGTGG + Intergenic
1154926717 18:20943194-20943216 TTCCTGTGCTGTTCTTGTGGGGG + Intergenic
1155599235 18:27525112-27525134 TTCCCAGGCTGTTCTTGTGATGG - Intergenic
1155644013 18:28055231-28055253 TCCCCACACTGTTCTCATGGTGG - Intronic
1156901787 18:42308891-42308913 TTCCCATGTTATTCTCATGATGG - Intergenic
1157002970 18:43549578-43549600 TACCCATGCTGTTCTTGTGATGG - Intergenic
1157040020 18:44027695-44027717 TTCCCTTGCTGTCCTAGTAGAGG + Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157531797 18:48427519-48427541 CCCCCATGCTGTTCTCATGATGG - Intergenic
1157960115 18:52144027-52144049 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1158670900 18:59472959-59472981 TCCCCATACTGTTCTCATGGTGG - Intronic
1158905235 18:62005430-62005452 TTCCCACGCTGTTCTCATGATGG - Intergenic
1158984898 18:62804221-62804243 CTCCCATGCTGTTCTCATGATGG - Intronic
1159152182 18:64534782-64534804 TTTGCATGCTGTTCTCATGATGG + Intergenic
1159640494 18:70858409-70858431 CTCCCATGCTGTTCTAGTGATGG + Intergenic
1160016485 18:75145125-75145147 TTCCCATGCTATTCTCATGGTGG - Intergenic
1160375027 18:78405375-78405397 TTCCTGTGCTGTTCTGGTGATGG - Intergenic
1161248247 19:3266959-3266981 CTCCCAGGCTGTGCTCGTGCGGG - Intronic
1161998128 19:7726999-7727021 TCCCCATACTGTTCTTGTGGTGG + Intergenic
1164523432 19:28996219-28996241 TTGCCTTGCTGTTCTTGTGATGG - Intergenic
1164911542 19:32016277-32016299 TTCCCGTGCTGTTCTCATGATGG + Intergenic
1165193988 19:34086887-34086909 TTCCCTTGCTGTTCTCATGGTGG + Intergenic
1166410176 19:42551416-42551438 TTCCCATGCTGTTCTTGTGATGG + Intronic
1166634174 19:44434926-44434948 TTCCCATGCTGTTCTCATGATGG + Intronic
1166770600 19:45279800-45279822 TTCCCAGGCTGCTCTCCAGGAGG + Intronic
1168495995 19:56851901-56851923 TTCCCATGCTGTTCTCATGATGG + Intergenic
1168496358 19:56854709-56854731 TTCCTGTGCTGTTCTCATGATGG + Intergenic
924966191 2:78473-78495 TTCCCAGGCTGTTCTCATGATGG - Intergenic
925254455 2:2471022-2471044 CTCCCATACTCTTCTCATGGTGG + Intergenic
925461787 2:4069316-4069338 CCCCCATGCTGTTCTCATGATGG + Intergenic
925723966 2:6855232-6855254 CCCCCTTGCTGTTCTCGTGATGG + Intronic
925803767 2:7628397-7628419 TTCCTGTGCTGTTCTTGTGATGG - Intergenic
926646704 2:15297463-15297485 CCCCCTTGCTGTTCTCGTGATGG + Intronic
926653410 2:15371091-15371113 CCCCCATGCTGTTCTCATGATGG + Intronic
926688226 2:15714977-15714999 TCCCCATACTGTTTTCCTGGTGG - Intronic
926744114 2:16136393-16136415 TTCCCATGCTATTCTCATGGTGG + Intergenic
926889215 2:17625044-17625066 CCCCCATACTGTTCTTGTGGTGG + Intronic
927623481 2:24687699-24687721 CCCCCATGCTGTTCTCGTGATGG - Intronic
928177285 2:29043318-29043340 TTCCCTTGCTGTCCTCCTGAGGG - Intronic
929027350 2:37617250-37617272 TCCCCATGCGGTTCTCGTGATGG + Intergenic
929264240 2:39900367-39900389 CCCCCATGCTGTTCTTGTGATGG + Intergenic
930081322 2:47451356-47451378 TTCCCATGCCGTTCTTGTGATGG - Intronic
930277535 2:49331109-49331131 TTCCCATGCTGTTCTCATGATGG - Intergenic
931445944 2:62327405-62327427 TTCCCATGCTATTTTCGTGATGG - Intergenic
932428141 2:71656776-71656798 TTCTCGTGCTATTCTCGTGGTGG - Intronic
932463723 2:71899501-71899523 CCCCCATGCTGTTCTCGTGATGG + Intergenic
933181152 2:79229357-79229379 TTCCCGTGCTATTCTCGTGATGG + Intronic
933397717 2:81753755-81753777 TTCCCATGCTATTCTTATGACGG - Intergenic
933455896 2:82518569-82518591 TCCCCTTGCTGTTCTCGTGATGG - Intergenic
934015263 2:87873803-87873825 TTTCCATGCTGTCCTCATGTTGG - Intergenic
934054843 2:88242935-88242957 CCCCCATACTGTTCTCATGGTGG + Intergenic
935419884 2:102855813-102855835 TTCCCATGCTGTTCTCATGATGG - Intergenic
935629325 2:105199702-105199724 TTCTCATGCTGTTCTCATGATGG + Intergenic
935746936 2:106196828-106196850 TCCCTATGCTGTTCTCATGATGG + Intergenic
936669397 2:114639296-114639318 TTCCCATGCTGTTTTCACGATGG - Intronic
936671195 2:114658950-114658972 CTCCCATGCCGTTCTCGTGATGG + Intronic
938988466 2:136603268-136603290 TTCCCATGCTGTTCTTGTGATGG - Intergenic
939050085 2:137297698-137297720 TTCCTGTGCTATTCTCCTGGTGG + Intronic
939657420 2:144845560-144845582 TTCCCATGCTGTTCTCATGATGG - Intergenic
939694809 2:145311430-145311452 TTCCTGTGCTGTTCTCATGATGG - Intergenic
939757170 2:146129014-146129036 CCCCCATGCTGTTCTCATGATGG - Intergenic
939810289 2:146823548-146823570 TTCTCATGCTGTTCTTGAGATGG + Intergenic
940199075 2:151130173-151130195 TTCCCATGCTGTTCTTGGCATGG - Intergenic
940387147 2:153086456-153086478 TTCCCATACTGTTCTCATGGTGG + Intergenic
940532989 2:154903984-154904006 TCCCCCTACTGTTCTTGTGGTGG + Intergenic
940814850 2:158287124-158287146 TTCCTGTGCTATTCTCGTGATGG - Intronic
940817485 2:158311816-158311838 TTCCCATGCTATGCTCATGAGGG + Intronic
941123593 2:161560555-161560577 TTCCCATGCTGTTCTTGCGATGG + Intronic
941143559 2:161815293-161815315 CCCTCATGCTGTTCTCGTGATGG + Intronic
941165621 2:162079952-162079974 TTCCCATGCTGTTCTCATGATGG - Intergenic
941349341 2:164413472-164413494 CTCCCATGCTGTTCTCATGATGG - Intergenic
941490787 2:166139763-166139785 TCCCCATACTGTTCTTGTGGTGG - Intergenic
941494242 2:166181088-166181110 TTCCCGGGCTGGTCTTGTGGAGG - Intergenic
941742028 2:169045101-169045123 TTCCCCTGCTATTCTCATGATGG + Intergenic
941816113 2:169797800-169797822 CCCCCATGCTGTTCTCCTGGTGG - Intronic
942130339 2:172872583-172872605 CTCCCTTGCTGTTCTCATGATGG + Intronic
942131624 2:172885665-172885687 CTCCCATACTGTTCTCGTGGTGG - Intronic
942695292 2:178635667-178635689 TTCACATGCTGGTCTCGTATAGG + Exonic
943189033 2:184652816-184652838 CCCCCATGCTGTTCTCCTGATGG + Intronic
944873995 2:203943534-203943556 TACCAGTGCTGTTCTGGTGGAGG + Intronic
945144435 2:206722229-206722251 CCCCCATACTGTTCTCATGGTGG + Intergenic
945495435 2:210502108-210502130 CCCCCATGCTGTTCTCATGATGG - Intronic
945560819 2:211337846-211337868 TCCCCATCCTGTTCTCATGATGG - Intergenic
945599412 2:211840174-211840196 TTCCTGTGCTGTTCTCATGATGG + Intronic
945844799 2:214931312-214931334 TGCACATGCTGTTCTCCTGCTGG - Intergenic
946480915 2:220055716-220055738 CCCCCATACTGTTCTCGTGGTGG + Intergenic
946656442 2:221953073-221953095 TCCCTGTGCTGTTCTCGTGGAGG + Intergenic
946755137 2:222936928-222936950 TCTCCATGTTGTTCTCGTGATGG - Intronic
946882849 2:224193653-224193675 TTCCCATGCTGTTCTCATGATGG - Intergenic
947071589 2:226293545-226293567 CCCCCATACTGTTCTCGTGATGG + Intergenic
947096490 2:226572733-226572755 CCTCCATACTGTTCTCGTGGTGG + Intergenic
947154944 2:227153134-227153156 GCCCCATACTGTTCTTGTGGTGG - Intronic
947886655 2:233577495-233577517 TTCCCATGCTGTTCTCATGACGG - Intergenic
948064774 2:235069406-235069428 CCCCCATACTGTTCTCATGGTGG - Intergenic
948294643 2:236851539-236851561 CCCCCATGCTGTTCTCATGATGG - Intergenic
949019090 2:241730977-241730999 TCCCCTTGCTGTTCTTGTGGAGG - Intergenic
1168957885 20:1847632-1847654 TTCCTGTGCTGTTCTCATGATGG - Intergenic
1169596634 20:7207550-7207572 TTACCATGCTGCTCTCATGTAGG + Intergenic
1169985077 20:11435265-11435287 TTTCTGTGCTGTTCTTGTGGTGG - Intergenic
1170007386 20:11684264-11684286 CCCCCATGCTGTTCTCGTGATGG - Intergenic
1170375254 20:15692912-15692934 CCCCCATGCTGTTCTCATGATGG + Intronic
1170449372 20:16466482-16466504 TTCCCATGCTGTTCTCTTGACGG + Intronic
1173662342 20:44743404-44743426 TCCCCATGCTGTTCTCGTGATGG + Intergenic
1173964747 20:47103671-47103693 CCCCCATGCTGTTCTTGTGGTGG - Intronic
1174116968 20:48232823-48232845 TTCCCATGCTATTCTTATGATGG + Intergenic
1174532393 20:51224438-51224460 TTCCCATGCTGTTCTCGTGAGGG + Intergenic
1174534023 20:51237068-51237090 TTCCCATTGTCTTCTCCTGGAGG + Intergenic
1177681961 21:24383203-24383225 TTCCCGTGCTGTTCTTGTGATGG - Intergenic
1177704396 21:24682602-24682624 TTCCCGTGCTATTCTCATGATGG - Intergenic
1178340003 21:31778191-31778213 TTCCCATGCTGTTCTCATGATGG + Intergenic
1178374035 21:32051572-32051594 CCCCCATGCTGTTCTTGTGACGG + Intergenic
1178738725 21:35176737-35176759 TCCCCTTACTGTTCTCATGGTGG - Intronic
1178862025 21:36297607-36297629 TCCCCATGCTGTTCTCATGATGG - Intergenic
1178939087 21:36890001-36890023 CTCCCATGCTGTCCTTGTGATGG + Intronic
1179067996 21:38044247-38044269 CCCCCATCCTGTTCTTGTGGTGG - Intronic
1179441942 21:41401050-41401072 TTCTCATGCTGCTCTCATGATGG - Intronic
1179468824 21:41597175-41597197 TTCCCGTGCTGTTCTTGTGATGG - Intergenic
1179915615 21:44476203-44476225 TCCCCAGGCTGTTCTTGTGATGG + Intergenic
1181392039 22:22590379-22590401 TCCCCTTGCTGTTCTCGTGATGG - Intergenic
1182536813 22:31009982-31010004 CCTCCATGCTGTTCTCATGGTGG + Intergenic
1182815030 22:33154895-33154917 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1183151426 22:36040794-36040816 TCCCCATCCTGTTCTTGTGATGG - Intergenic
1183383270 22:37501216-37501238 TGCCCATGCTGTTCCTGGGGAGG - Intronic
1184312072 22:43652222-43652244 TTCCTGTGCTGTTCTCTTGATGG + Intronic
1184386291 22:44176954-44176976 TTTCCATGCTGTTCTCATGATGG - Intronic
1184847952 22:47100548-47100570 TTCCCATGCTGTTCTCATGATGG + Intronic
1184936930 22:47731440-47731462 TTCCCATGCTGCTCTCATAATGG + Intergenic
949575129 3:5331450-5331472 CCCCCATGCTGTTCCCGTGATGG - Intergenic
949665130 3:6330586-6330608 TTCCCATGCTGTTCTTGTGATGG + Intergenic
949745920 3:7291907-7291929 CCCCCATACTGTTCTCATGGTGG + Intronic
949939597 3:9144564-9144586 TTCCCATGCTGTTCTCGTAATGG + Intronic
950071581 3:10157019-10157041 TCCCCAGGCTGTTCTCATGATGG - Intergenic
950244876 3:11406795-11406817 TTCCCATGCTGCTCTGGTGATGG - Intronic
950412347 3:12847260-12847282 TCCCCATACTGTTCTCGTGGTGG + Intronic
950908878 3:16566778-16566800 TTCCCATGCTGTTCTCATGATGG - Intergenic
950915589 3:16641805-16641827 CCCCCATGCTGTTCTTGTGATGG + Intronic
951054912 3:18136404-18136426 TTCCCATGCTGTTCTCGTGATGG - Intronic
951091928 3:18584272-18584294 TTCCCATGCTGTTCTTGTGATGG - Intergenic
951126880 3:18995359-18995381 TTCCTGTGCTGTTCTTGTGGTGG - Intergenic
951127156 3:18997305-18997327 TTCCTGTGCTGTTCTTGTGGTGG - Intergenic
951166992 3:19494336-19494358 TTCCCTTGCTGTTCTCATGATGG + Intronic
951358811 3:21701374-21701396 TTCCCGTGCTATTCTCATGATGG - Intronic
951452390 3:22853880-22853902 CTCCCATACTGTTCTCATGGAGG - Intergenic
951799813 3:26583260-26583282 GTCCAATTCTGTTCTCCTGGCGG + Intergenic
952185373 3:30962270-30962292 ATCCCATGCTGTTCACATGATGG - Intergenic
952246959 3:31605480-31605502 ATCTCATACTGTTCTCATGGTGG + Intronic
952247234 3:31607428-31607450 TCCCCATACTGTTCTCCTGGTGG + Intronic
952689018 3:36181887-36181909 GCCCCTTGCTGTTCTTGTGGTGG - Intergenic
954502851 3:51036820-51036842 TTCCCATGCTGTTCACCTGATGG + Intronic
954809453 3:53239041-53239063 TCCCCATGCTGTTCTCGTGATGG + Intronic
955513974 3:59708505-59708527 TTCCCCTGCTGTTCTCATTCTGG - Intergenic
955547344 3:60045457-60045479 TTCCCAAGCTGTTCTCATGATGG - Intronic
956080528 3:65551112-65551134 CTGCCATGCTGTTCTCATGATGG + Intronic
956149833 3:66229452-66229474 CCCCCATGCTGTTCTCCTGATGG + Intronic
956357421 3:68409410-68409432 CCCCCATGCTGTTCTCATGATGG + Intronic
956700958 3:71958059-71958081 CCCCTATACTGTTCTCGTGGTGG - Intergenic
957030575 3:75236086-75236108 TTCCCATGCTGTCCTAGCAGAGG - Intergenic
957114082 3:76002483-76002505 TCCCCATACTGTTCTTGTAGTGG + Intronic
957189150 3:76984081-76984103 CCCCCATGCTGTTCTTGTGATGG - Intronic
957261497 3:77907847-77907869 TTCCCATGCAGTTGTCATGACGG + Intergenic
957477380 3:80742629-80742651 TCCCTATGCTGTTCTTGTGATGG - Intergenic
957502290 3:81072736-81072758 ATCCCATGCTGTTCTTGTGATGG - Intergenic
957597637 3:82288061-82288083 TTCCCATACTGATCTTGTGAAGG - Intergenic
958423816 3:93958668-93958690 CCCCCATACTGTTCTCATGGTGG + Intronic
958638750 3:96778542-96778564 TTCCCATGCTGTTCTCATGATGG - Intergenic
958660682 3:97062640-97062662 CCCCCATACTGTTCTCATGGTGG + Intronic
958710483 3:97711114-97711136 TTCCCGTGCTGTTCTTGTGATGG + Intronic
958860378 3:99438004-99438026 TTCCCATTCTGTTCTCATGATGG + Intergenic
959326050 3:104937858-104937880 TTCCCATGCTGTTCTCATGACGG + Intergenic
959718027 3:109454995-109455017 TTCACAAGCTGTTCTTGTGACGG - Intergenic
959740942 3:109719100-109719122 CCCCCATGCTGTTCTCCTGATGG - Intergenic
959890266 3:111546863-111546885 TTCCCTTGCTGTTTTCCAGGAGG + Intronic
960181828 3:114589032-114589054 CTCCCATGATTTTCTCGTGATGG - Intronic
960501929 3:118448222-118448244 CACTCATGCTGTTCTCGTGATGG - Intergenic
960738857 3:120810700-120810722 TTCCCATGCTGTTCTCATGATGG + Intergenic
962128976 3:132652178-132652200 TTCCTGTGCTGTTCTCATGATGG + Intronic
962339364 3:134569059-134569081 TTCTCACGCTGTTCTCGTGATGG - Intronic
962853547 3:139325501-139325523 CCCCCATACTGTTCTTGTGGTGG - Intronic
963229053 3:142891484-142891506 CCCCCATGCTGTTCTCCTGGTGG - Intergenic
963239664 3:142990769-142990791 TCCCCATGCTGTTCTCATGATGG + Intronic
963418480 3:145028484-145028506 TTCCCATGCTGTTCTCTTGATGG + Intergenic
964015790 3:151944872-151944894 TTCCCGTGCTGTTCTAATGATGG + Intergenic
965169313 3:165240634-165240656 CCCCCATACTGTTCTCATGGTGG + Intergenic
965203500 3:165692017-165692039 TTCCCATGCTGTTCTTGTGATGG - Intergenic
965203764 3:165693941-165693963 TTCCCATGTTGTTCTCATGATGG - Intergenic
965387030 3:168057085-168057107 TTCCTGTGCTGTTCTCATGACGG + Intronic
965458043 3:168929060-168929082 TCCCCATACTGTTCTTGTGGTGG - Intergenic
965777190 3:172243548-172243570 TTCCCGTGCTGTTCTCATGATGG - Intronic
965864928 3:173194778-173194800 TTCCCGTGCTGTTCTTGTGATGG + Intergenic
966508167 3:180730620-180730642 TTCCCATGCTGTTCTCGTGGTGG - Intronic
967615563 3:191561142-191561164 TCCCCATGCTGTTCTCATGATGG - Intergenic
967736646 3:192960003-192960025 CCCCCATACTGTTCTCGTGATGG - Intergenic
968014564 3:195318013-195318035 TCCCCATGCTGTTCTCGTGATGG + Intronic
968387371 4:154039-154061 CCCCCATACTGTTCTCATGGTGG + Intronic
968557730 4:1256298-1256320 TTCCCATGCTGTTCTCGTGGTGG + Intergenic
968749933 4:2383284-2383306 CCCCCATACTGTTCTCATGGTGG + Intronic
968766974 4:2477252-2477274 TTCCCATGCTGTTCTCATGATGG + Intronic
969293555 4:6255828-6255850 CCCCCATGCTGTTCTCGTCACGG + Intergenic
969596981 4:8155000-8155022 CCCCCATACTGTTCTCATGGTGG - Intronic
969622889 4:8287614-8287636 CCCCCATGCTGTTCTCATGGTGG - Intronic
969862204 4:10046464-10046486 CTCCTATGCTGTTCTTGTGATGG - Intronic
969963871 4:10974664-10974686 TCCTCACGCTGTTCTCGTGATGG - Intergenic
970224420 4:13842718-13842740 CCCCCATGCTGTTCTCATGATGG + Intergenic
970340274 4:15099165-15099187 TTCCCCCGCTGTTCTTGTGATGG + Intergenic
970403984 4:15744458-15744480 CCCCCATGCTGTTCTCCTGATGG - Intergenic
970933331 4:21538971-21538993 TCTCCATGCTGTTCTCCTGACGG + Intronic
971073997 4:23127081-23127103 TTCCTGTGCTGTTCTCGCGATGG + Intergenic
971209717 4:24604054-24604076 TCTCCATGCTGTTCTCATGATGG - Intergenic
971601598 4:28598239-28598261 TCCCCATGCTATTCTCTTGAAGG + Intergenic
971728425 4:30344352-30344374 TCCCCATACTGTTCTTGTGGTGG - Intergenic
972056072 4:34805327-34805349 TTCCCCTGCTGTTCTCATGATGG - Intergenic
972087670 4:35240638-35240660 CCCCCATGCTGTTTTCATGGTGG + Intergenic
972210157 4:36826771-36826793 TTCCCGTGCTGTTCTTGTGATGG + Intergenic
972629070 4:40827936-40827958 CCCCCATACTGTTCTCGTGGTGG + Intronic
972646115 4:40968919-40968941 CCCCCATACTGTTCTCATGGTGG + Intronic
972687694 4:41367079-41367101 ACCCCATGCTGTTCTCATGATGG - Intronic
972879656 4:43407827-43407849 TCTCCATACTGTTCTTGTGGTGG - Intergenic
974230039 4:59100126-59100148 TTCTCCTGCTGTTCTCGTGATGG - Intergenic
974259414 4:59505812-59505834 CCCCCATGCTGTTCTTGTGAAGG - Intergenic
974455718 4:62127509-62127531 TTCCTGTGCTGTTCTCATGATGG + Intergenic
974477979 4:62407283-62407305 TTCCCATCCTGTTCTCACGATGG + Intergenic
974531160 4:63109361-63109383 TTCCCATGCTGTTCTCATGATGG + Intergenic
974925448 4:68292395-68292417 TTCCTGTGCTGTTCTTGTGATGG - Intergenic
974965932 4:68760896-68760918 TTCCCATGCTATTCTCATGACGG - Intergenic
975110540 4:70618315-70618337 CCCCCATACTGTTCTCGTGATGG + Intergenic
975876056 4:78838216-78838238 TTCCTGTGCTGTTCTCGTGATGG - Intronic
975896558 4:79099553-79099575 TTCCCATGCTGTTCTCTTGATGG + Intergenic
976473932 4:85461183-85461205 TTCCCATGCAGTTCCTGTGTGGG + Intergenic
976635519 4:87283254-87283276 TTCCTGTGCTGTTCTCCTGATGG + Intergenic
977015189 4:91683451-91683473 TTCCCATGCTGTTCTGGGGATGG - Intergenic
977026215 4:91822022-91822044 TTTCCTTGCTATTCTCGTGATGG - Intergenic
977198795 4:94090501-94090523 TTCCTGTGCTTTTCTCGTGATGG - Intergenic
977383432 4:96307440-96307462 TTCCTGTGCTGTTCTCCTGATGG + Intergenic
977846313 4:101772155-101772177 TTCCTGTGCTGTTCCCATGGTGG + Intronic
978045111 4:104115693-104115715 TTTCCATACTGTTCTCATGATGG - Intergenic
978083269 4:104620549-104620571 TTCCTATGCTGCTCTCATGATGG - Intergenic
978240057 4:106504579-106504601 TCCTCATACTCTTCTCGTGGTGG + Intergenic
978994490 4:115132749-115132771 TTCCCATGTTGTTCTTGTGATGG + Intergenic
979063680 4:116099220-116099242 TACCCATATTGTTCTCATGGTGG + Intergenic
979547635 4:121955458-121955480 CCCCCATACTGTTCTCATGGTGG - Intergenic
979759035 4:124376647-124376669 TTCCCATGGTGTTCTCTTGGTGG - Intergenic
980242052 4:130190259-130190281 TTCCCATGCTGTTCATGTAATGG + Intergenic
980396468 4:132222368-132222390 TCCCCTTGCTGTTCTCATGATGG + Intergenic
980430641 4:132689484-132689506 TCCCCATGCTATTCTTGTGATGG + Intergenic
980720538 4:136688623-136688645 TTCCCATGCTGTTGTTGTGATGG - Intergenic
981356746 4:143798357-143798379 TCCACATGCTGTTCTCATGATGG - Intergenic
981359760 4:143832450-143832472 CCCCCATGCTGTTCTCATGATGG + Intergenic
981378068 4:144039225-144039247 TCCCCATGCTGTTCTTATGATGG - Intergenic
981512400 4:145572324-145572346 CCCCCATACTGTTCTCATGGTGG - Intergenic
981863038 4:149379935-149379957 CCCCCATACTGTTCTCATGGTGG + Intergenic
981974951 4:150715322-150715344 TTGCCAGGCTATTCTGGTGGTGG + Intronic
982671091 4:158320698-158320720 TTCCTGTGCTGTTCTTGTGACGG + Intronic
982886323 4:160787631-160787653 TTCCCATGGTGTTCTCATGATGG + Intergenic
983013421 4:162579128-162579150 CCCCCATGCTGTTCTCATGATGG + Intergenic
983121528 4:163891171-163891193 TTGCCATGCTTTTATCTTGGTGG + Intronic
983340366 4:166453696-166453718 TTCTTATGCTGTTCTTGTGATGG + Intergenic
983772571 4:171569953-171569975 TTCCCATGGTGTTCTCCTGGTGG - Intergenic
984232001 4:177111408-177111430 TTCCTGTGCTGTTCTTGTGATGG - Intergenic
984507364 4:180636594-180636616 TTCTCCTGCTGTTCCCCTGGAGG + Intergenic
984553446 4:181186556-181186578 TCCCCATACTGTTCCTGTGGTGG - Intergenic
985184156 4:187297534-187297556 TTCCCATGCTATTCTCATGAGGG - Intergenic
985201567 4:187489712-187489734 TTCCCATGCTGTTCTCCTGATGG + Intergenic
985220129 4:187695583-187695605 TTCCTGTGCTGTTCTCATGATGG + Intergenic
985371885 4:189293685-189293707 TCCCCATGCTGTTTTCATGATGG + Intergenic
985785923 5:1894480-1894502 CCCCCATACTGCTCTCGTGGTGG + Intergenic
985842773 5:2321092-2321114 TTCCCATGCTGTTCTCGTGATGG + Intergenic
985867086 5:2522491-2522513 CCCCCTTGCTGTTCTGGTGGTGG + Intergenic
986289844 5:6390949-6390971 TCCCCATGCTATTCTCATGATGG + Intergenic
986751979 5:10795383-10795405 CCCCCATGCTGTTCTCATGATGG + Intergenic
986817420 5:11428060-11428082 TTTTCATGCTGTTCTCGTGGTGG - Intronic
987011274 5:13768229-13768251 CCCCCATGCTGTTCTCATGATGG + Intronic
987479897 5:18440507-18440529 TTCCCATGCTGTTTTCATAATGG - Intergenic
987620938 5:20338040-20338062 TTCCCATCGTGTTCTCCTGGTGG - Intronic
987659425 5:20853890-20853912 TTCCTGTGCTGTTCTCATGATGG + Intergenic
988396588 5:30704113-30704135 CCCCCATGCTGTTCTCGTGATGG - Intergenic
988642998 5:33062333-33062355 CCCCCATGCTGTTCTCCTGATGG - Intergenic
988834453 5:35017450-35017472 CCCCCATACTGTTCTCATGGTGG + Intronic
989289880 5:39750843-39750865 TTCCCATGCTGTTGTCATGATGG + Intergenic
989783746 5:45302224-45302246 CCCCCATGTTGTTCTCATGGTGG + Intronic
990143244 5:52730058-52730080 TCCCCATGCTGTTCTCATGATGG + Intergenic
991343612 5:65639133-65639155 TTCCTGTGCTGTTCTCATGACGG - Intronic
991355610 5:65766439-65766461 CCCCCATGCTGTTCTCGTGATGG - Intronic
991355902 5:65768412-65768434 CCCCCATGCTGTTCTCATGATGG - Intronic
991606013 5:68401847-68401869 CCCCCATGCTGTTCTTGTGATGG - Intergenic
992259024 5:74951598-74951620 TCCCCATTGTGTTCTCTTGGTGG + Intergenic
992781368 5:80131204-80131226 TTCCCATGCTGTTCTCATAGTGG + Intronic
993208667 5:84920408-84920430 TTCCCACGCTATTCTCATGATGG + Intergenic
993293666 5:86108003-86108025 TTCCCATGCTGTTCTTGTGATGG + Intergenic
993293947 5:86109966-86109988 TTCCCGTGCTCTTCTCCTGATGG + Intergenic
994652828 5:102550531-102550553 TTCCCATGCTGTTCTTGTGATGG - Intergenic
994694566 5:103057934-103057956 TTTCCATGGTGTTCTTGTGATGG - Intergenic
994749752 5:103722801-103722823 TCCCCATGCTGTTCTCGTGACGG - Intergenic
995090636 5:108171859-108171881 TTCCCATGCTGTTCTTGCAATGG + Intronic
995233423 5:109797732-109797754 TTACCATGGTGTACTCGGGGTGG - Intronic
995312546 5:110730693-110730715 TTCCTGTGCTATTCTCGTGATGG - Intronic
995332538 5:110961211-110961233 CCCCCATGCTGTTCTCATGATGG - Intergenic
995573521 5:113506171-113506193 TTTCCAGGGTGTTCTCCTGGTGG + Intergenic
995914708 5:117230616-117230638 TCCCCATTCTGTTCTCATGATGG - Intergenic
995997735 5:118321902-118321924 CCCCCATGCTGTTCTCATGATGG - Intergenic
996196484 5:120612490-120612512 TTCCCATGCTATTCTCGTGACGG + Intronic
996238449 5:121164719-121164741 TTCCTGTGCTATTCTCGTGTTGG + Intergenic
996401299 5:123066016-123066038 TTCTCATGCTGTTCTTGTGATGG - Intergenic
996490235 5:124086151-124086173 TTCCCGTGCTATTCTCATGATGG + Intergenic
996600310 5:125254713-125254735 TTCCCGTGCTGTTCTCATGATGG - Intergenic
996627701 5:125589483-125589505 TTCTCATGCTGTTCTTGTGATGG - Intergenic
996636006 5:125691019-125691041 TTCCCATGCTGTTCTCATGGTGG + Intergenic
996670450 5:126112140-126112162 TTCCCATGCTATTCTTGTGCTGG + Intergenic
996682704 5:126245930-126245952 CCCCCATCCTGTTCTCGTGATGG - Intergenic
996912971 5:128676711-128676733 TTCTCATACTGTTCTCGTGATGG + Intronic
997161558 5:131614549-131614571 CCCCCTTGCTGTTCTCGTGATGG - Intronic
999051574 5:148529389-148529411 TTCCCATGTTGTTCTCATGATGG + Intronic
999051833 5:148531335-148531357 TCCCCATGCTATTCTCATGATGG + Intronic
999426924 5:151496143-151496165 TTCCTGCGCTGTTCTCGTGATGG + Intergenic
999960817 5:156753760-156753782 CCCCCATGCTGTTCTCATGATGG - Intronic
1000083552 5:157869371-157869393 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1000766791 5:165301568-165301590 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1001851848 5:174974666-174974688 TTCCCATGCTGTTCTCATGATGG - Intergenic
1002442036 5:179269524-179269546 TTCCCATGCTGTTCTCATGATGG - Intronic
1003180289 6:3785027-3785049 CCCCCATGTTGTTCTCGTGATGG + Intergenic
1003280881 6:4690399-4690421 TCCCCTTGCTGTTCTCGTGATGG - Intergenic
1003401619 6:5795522-5795544 TTCCCATGCTATTCTCCTGATGG - Intergenic
1005180049 6:23094557-23094579 TTCCTATGCTGTTCTCATGATGG + Intergenic
1008025741 6:46634159-46634181 TTCTAGTGCTGTTCTCGTGATGG + Intronic
1008260370 6:49359106-49359128 TTCCCGTGCTGTTCTCATGATGG + Intergenic
1008411047 6:51180193-51180215 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1008650238 6:53553764-53553786 TTCCCATGCTATTCTCGTGATGG + Intronic
1009608564 6:65906552-65906574 TTCCCATGCTGTTCTCATAATGG - Intergenic
1009726182 6:67538126-67538148 TTCCCTTGCTTTTCTTGTGGTGG + Intergenic
1010163470 6:72887364-72887386 TTCCTGTGCTGTTCTTGTGATGG - Intronic
1010525779 6:76898835-76898857 TTCCCATGTTATTCTTGTGATGG - Intergenic
1010845659 6:80703308-80703330 TTCCATTGCTGTTCTTGTGATGG + Intergenic
1010900677 6:81423631-81423653 CCCCCATGCTTTTCTCGTGATGG + Intergenic
1010947076 6:81987424-81987446 TTCCTGTGCTGTTCTTGTGGTGG + Intergenic
1011011043 6:82704671-82704693 TTCCCATGCTGTTCTCATGATGG - Intergenic
1011046643 6:83091170-83091192 TTCCCATGGTATCCTCATGGTGG - Intronic
1011121715 6:83961446-83961468 CCCCCATGCTGTTCTCATGATGG + Exonic
1011724767 6:90198908-90198930 TTCCCATGCTGTTCTTGTGACGG + Intronic
1012029079 6:94035948-94035970 TCCCCATGCTGTTCTAGTAATGG + Intergenic
1013661095 6:112297876-112297898 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1014220157 6:118791853-118791875 TTCCTGTGCTGTTCTCTTGATGG - Intergenic
1014562875 6:122912808-122912830 CTCCAATGCTGTTCTCATGATGG + Intergenic
1014646195 6:123975979-123976001 TTTCCATGCTGTTCTGATGATGG + Intronic
1015386719 6:132633095-132633117 TCCCCATGCTGTTCTCGTGATGG + Intergenic
1015431929 6:133141952-133141974 TTCTCATGCTGTTCTTGTGATGG + Intergenic
1015652325 6:135477586-135477608 TCCCCTTGCTGTTCTCGTGATGG + Intronic
1015908675 6:138144845-138144867 CCCCTATACTGTTCTCGTGGTGG + Intergenic
1016134294 6:140519980-140520002 TTCCTGTGCTGTTCTCATGGTGG + Intergenic
1016291662 6:142534590-142534612 TTACCATGCTATTCTCATGATGG + Intergenic
1016304672 6:142671210-142671232 CTCCCATGCTGTTCTAGTGGTGG + Intergenic
1016565021 6:145442534-145442556 CCCCCATACTGTTCTCATGGTGG - Intergenic
1018219660 6:161565487-161565509 CCCCCATGGTGTTCTCGTGATGG + Intronic
1018705106 6:166458276-166458298 TTCCTGTGCTGTTCTCATGATGG + Intronic
1018866759 6:167752481-167752503 TTTCCATGCTATTCTTGTGATGG - Intergenic
1019947236 7:4339443-4339465 TTCTCATGCTGTTCTCGTGATGG + Intergenic
1019953771 7:4395357-4395379 TCCCCATGCTGTTCTCATGATGG + Intergenic
1020631697 7:10648640-10648662 TTCCCTTGCTGTTCTGGTGATGG - Intergenic
1021192863 7:17642697-17642719 TTCCCATGTTGTTCTTGTGATGG + Intergenic
1021857083 7:24867491-24867513 TTCCCATGGTGTTCTCGTGGTGG + Intronic
1023684249 7:42718551-42718573 TTCCCATGCTGTTCTCATGATGG + Intergenic
1023845977 7:44120633-44120655 CCCCCATGCTGTTCTTGTGATGG + Intronic
1024131216 7:46354703-46354725 TGCCCATGCTGTTCACCAGGGGG + Intergenic
1024424883 7:49213724-49213746 TTCCAGTGCTGTTCTCATGATGG - Intergenic
1026332140 7:69361643-69361665 TTCCCATGCTATTCTCGTGATGG + Intergenic
1026497825 7:70919011-70919033 CTCCCATGCTGTTCTGATAGTGG + Intergenic
1026640437 7:72119776-72119798 TTCCCATGCTCTTCTTGTGGTGG - Intronic
1027728554 7:81839767-81839789 CCCCCATACTGTTCTCATGGTGG + Intergenic
1027915993 7:84322118-84322140 CCCCCATGCTGTTCTCATGATGG - Intronic
1028134033 7:87207961-87207983 CCCCCATACTGTTCTCGTGGTGG - Intronic
1028204922 7:88005495-88005517 TACCCAAGCAGTTCTTGTGGAGG + Intronic
1028265534 7:88719256-88719278 TTCCCATGCTGTTCTTGTGGTGG + Intergenic
1028893990 7:96020453-96020475 TTCCCATGGTGTTCTTGCGCTGG - Intronic
1029454456 7:100661392-100661414 TGTCCATGCTGTTCTCTTTGTGG - Intergenic
1030783714 7:113633971-113633993 CTCCCATGCTATTCTCATGATGG - Intergenic
1030826633 7:114167587-114167609 TTCCCGTGCTGTTCTCGTGATGG + Intronic
1030986056 7:116243995-116244017 CCCTCATGCTGTTCTCGTGATGG - Intronic
1031174909 7:118338093-118338115 TTCCCATGCTGTTCTCCTGATGG + Intergenic
1031193537 7:118585706-118585728 CCCCCATACTGTTCTTGTGGTGG + Intergenic
1031275108 7:119711884-119711906 TTCCCATACTATTCTCATGACGG - Intergenic
1031277392 7:119745557-119745579 TTCCCATGCTGTTCTCATGATGG - Intergenic
1032275897 7:130455107-130455129 TTCCTGTGCTGTTCTAGTGAAGG - Intergenic
1032963362 7:137066612-137066634 CCCCCATACTGTTCTTGTGGTGG + Intergenic
1033224836 7:139553246-139553268 TTCCCATGCTGTTCTCATGATGG + Intergenic
1033225124 7:139555174-139555196 TTCTGGTGCTGTTCTCGTGATGG + Intergenic
1033418184 7:141182723-141182745 CTCCCATACTGTTCTTGTGGTGG + Intronic
1034115410 7:148579535-148579557 TTCCCAGGCTGTTCTTGTGATGG - Intergenic
1034739954 7:153464733-153464755 CCCCCACTCTGTTCTCGTGGTGG + Intergenic
1035135176 7:156696654-156696676 TTCCCATGCTGTTGTTGTGATGG - Intronic
1035990356 8:4483106-4483128 CCCCCATACTGTTCTCCTGGTGG + Intronic
1036406428 8:8459563-8459585 TCCCCATATTGTTCTCATGGTGG - Intergenic
1036412065 8:8511554-8511576 TCCCCATACTGTTCTTGTGGTGG - Intergenic
1036499575 8:9300958-9300980 TTCCCAAGCTATTCTCGTGATGG - Intergenic
1036993819 8:13631269-13631291 TTCCTGTGCTGTTCTCATGATGG - Intergenic
1037141605 8:15526518-15526540 CCCCCATACTGTTCTCCTGGTGG + Intronic
1037239945 8:16765902-16765924 TTCCCGTGCTGTTCTCCTGATGG + Intergenic
1037310337 8:17549125-17549147 TTCCTGTGCTGTTCTTGTGATGG - Intronic
1037384390 8:18322148-18322170 TCCCCATGCTGTTCTCATGATGG - Intergenic
1037565653 8:20116137-20116159 CTCCCATACTGTTCTCATGGTGG - Intergenic
1037641991 8:20753262-20753284 TTCCTGTGCTGTTCTCTTGATGG + Intergenic
1038360779 8:26873895-26873917 TTCCCATGCTGTTCTCGTGGTGG - Intergenic
1038437605 8:27547056-27547078 CCCCCTTGCTGTTCTCGTGATGG - Intergenic
1038706441 8:29898341-29898363 TTCCCATGCTGTTCTCATGATGG - Intergenic
1038848489 8:31251812-31251834 CCCCCATACTGTTCTCGTGGTGG - Intergenic
1039272899 8:35902545-35902567 CCCCCATGCTGTTCTCATGCTGG + Intergenic
1039320272 8:36422347-36422369 CCCCCATACTGTTCTCATGGTGG + Intergenic
1039668667 8:39568448-39568470 CCCTCATGCTGTTCTCATGGTGG - Intergenic
1039828097 8:41191929-41191951 CCCCCATGCTTTTCTCGTGATGG - Intergenic
1041020398 8:53632844-53632866 TTTCCATGTTGTTCTCCTGATGG - Intergenic
1041075134 8:54162001-54162023 TTCCCATGCTATTCTCGTGGTGG + Intergenic
1041429384 8:57761862-57761884 CTCCCATGCTGTTCTCATCCTGG + Intergenic
1041445175 8:57943571-57943593 TTCCCATGCTTTTCTACTGGAGG - Intergenic
1041878473 8:62718115-62718137 TTCTCATGCTATTCTCGTGATGG - Intronic
1042427263 8:68662482-68662504 CCCCCATACTGTTCTCGTTGTGG + Intronic
1042485289 8:69340244-69340266 TTCCTGTGCTGTTCTTGTGATGG + Intergenic
1043088069 8:75861914-75861936 CCCCCATACTGTTCTCATGGTGG + Intergenic
1043111308 8:76186519-76186541 TTCCTGTGCTGTTCTCATGTTGG - Intergenic
1043426249 8:80151087-80151109 TTCTCGTGCTGTTCTTGTGATGG + Intronic
1043493164 8:80770076-80770098 TTCCTGTGCTGTTCTCATGATGG - Intronic
1043518418 8:81018561-81018583 TTCCCATGCTGTTCTCATGATGG + Intronic
1043518700 8:81020444-81020466 TTCCCATGTTGTTCTCATAATGG + Intronic
1043824994 8:84916468-84916490 TTCCCGTGCTGTTCTTGTGATGG + Intronic
1044149358 8:88755215-88755237 TTCCTGTGCTGTTCTCATGATGG - Intergenic
1044495662 8:92877697-92877719 TCCCCCTGCTGCTCTCGTGAAGG - Intergenic
1045270276 8:100655453-100655475 CCCCCATACTGTTCTCGTGGTGG + Intronic
1045646885 8:104308068-104308090 CCCCCATACTGTTCTCATGGTGG - Intergenic
1045649790 8:104330803-104330825 TCCCTATGCTGTTCTCCTGATGG + Intronic
1045676017 8:104608445-104608467 TCCCCATGCTGTCCTCATGAGGG + Intronic
1045931644 8:107633756-107633778 CCCCCATGCTGTTCTCATGATGG + Intergenic
1046207065 8:111014835-111014857 TTCCCGTGCTGTTCTCATGATGG + Intergenic
1046244286 8:111538512-111538534 CCCTCATGCTGTTCTCGTGATGG + Intergenic
1047091418 8:121579749-121579771 TTCCTGTGCTGTTCTCCTGATGG - Intergenic
1047562737 8:126007366-126007388 TTCCTGTGCTATTCTCGTGATGG - Intergenic
1047565472 8:126039510-126039532 TTCCTGTGCTGTTCTCGTGTTGG + Intergenic
1047565717 8:126041360-126041382 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1047574490 8:126137826-126137848 TTCCCCTGCTGTTCTTGTGATGG - Intergenic
1047899017 8:129399483-129399505 TTCCCATGCTGTTTTCATGATGG - Intergenic
1048589124 8:135804712-135804734 CCCCCATGCTGTTCTCGTGATGG + Intergenic
1048736787 8:137510884-137510906 TTCCCATGCTGTTCTCGTGATGG + Intergenic
1048839226 8:138550289-138550311 CTCCCTTGCTGTTCTCATGATGG + Intergenic
1049036334 8:140079043-140079065 TTCCAATGCTGTTTTCGTGATGG + Intronic
1051085096 9:13339366-13339388 TTCCCATGCTGTCCTTGTGATGG - Intergenic
1051384249 9:16490344-16490366 TTCCCTTGCTCTTCTCTTGATGG - Intronic
1051582594 9:18694128-18694150 CTCCCTTGCTGTTCTCGTGATGG - Intronic
1051741308 9:20254965-20254987 TTCCTGTGCTGTTCTCATGATGG - Intergenic
1052070844 9:24079997-24080019 TTCCCATGATATTCTTGTGACGG + Intergenic
1052737444 9:32357211-32357233 TTCCCATGCAGTTCTCGTGATGG - Intergenic
1053520792 9:38776885-38776907 TTCACAAGCTGTTCTCTTTGTGG - Intergenic
1053572087 9:39319680-39319702 CCCCCATGCTGTTCTCATGATGG + Intergenic
1054093643 9:60878391-60878413 CCCCCATGCTGTTCTCATGATGG + Intergenic
1054115126 9:61154311-61154333 CCCCCATGCTGTTCTCATGATGG + Intergenic
1054125058 9:61299331-61299353 CCCCCATGCTGTTCTCATGATGG - Intergenic
1054192948 9:62000877-62000899 TTCACAAGCTGTTCTCTTTGTGG - Intergenic
1054592630 9:67028223-67028245 CCCCCATGCTGTTCTCATGATGG - Intergenic
1054645459 9:67587814-67587836 TTCACAAGCTGTTCTCTTTGTGG + Intergenic
1055167717 9:73217886-73217908 TTCCTGTGCTGTTCTTGTGATGG + Intergenic
1055168024 9:73220100-73220122 TTCTCATGCTGTTCTTGTGATGG + Intergenic
1055252144 9:74320580-74320602 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1055815100 9:80195608-80195630 CCCCCATACTGTTCTCATGGTGG + Intergenic
1055820917 9:80262736-80262758 TTCCCATTCTGTCTTCTTGGTGG - Intergenic
1056283803 9:85068362-85068384 TTCCCATGCTATTCTTGTGATGG + Intergenic
1056367034 9:85915900-85915922 CCCCCATACTGTTCTCATGGTGG + Intergenic
1056577094 9:87863977-87863999 TTTCCATGCTGTGCTCATGCTGG + Intergenic
1058323203 9:103659377-103659399 CTCCCATGCTGTTCTTGTGATGG + Intergenic
1058892810 9:109375277-109375299 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1058987707 9:110224244-110224266 TTCCCATGCTGTTCTCATAGTGG + Intergenic
1059714060 9:116896810-116896832 TCCCCATGCTGTTCTCATGATGG - Intronic
1060268530 9:122126137-122126159 TGCACATGCTGTTCTCTTGCTGG - Intergenic
1060570576 9:124635371-124635393 TCCCCATGCTGTTCTCGTGAGGG + Intronic
1060762015 9:126261566-126261588 CCCCCATACTGTTCTCGTGAGGG + Intergenic
1060839888 9:126784960-126784982 TTCCCATGCTAGTCTAGTGATGG + Intergenic
1062127698 9:134872695-134872717 TTCTCGTGCTGTTCTCGTGATGG - Intergenic
1186000600 X:5005230-5005252 TCCCCTTGCTGTTCTCATGATGG - Intergenic
1186294246 X:8131619-8131641 TCCTCATGCTATTCTCGTGATGG + Intergenic
1186439710 X:9575215-9575237 CCCCCATGCTGTTCTTGTGATGG - Intronic
1186663353 X:11692420-11692442 TTCCCATGCTGTTCACATGATGG + Intergenic
1187187574 X:17001892-17001914 TTCCCATGCTATTCTTGTGATGG - Intronic
1187948924 X:24452960-24452982 TTCCTGTGCTGTTCTCGTGATGG + Intergenic
1188393720 X:29654575-29654597 TTCCCATGCTGTTCTTGTGATGG - Intronic
1188753959 X:33937231-33937253 TTCCTATGCTGTTCTTGTGATGG - Intergenic
1188818295 X:34742147-34742169 TTCCCCTGCTGTTCTTGTAATGG + Intergenic
1189230688 X:39450450-39450472 TTCCCATGCTTCACTCGTTGGGG - Intergenic
1190376188 X:49790716-49790738 TTCCCTTGCTGTTCTTGTGATGG - Intergenic
1190566707 X:51737826-51737848 TTCCCATGCTGTTCTCGTGATGG + Intergenic
1191188706 X:57641064-57641086 CCCCCATACTGTTCTTGTGGTGG + Intergenic
1192132763 X:68568394-68568416 ACCCCATACTGTTCTCCTGGTGG - Intergenic
1192751857 X:74000413-74000435 TTCCCGTGCAGGTCTAGTGGTGG - Intergenic
1193027214 X:76857127-76857149 TTCCCATACTGTTCTCATGGTGG - Intergenic
1193188426 X:78540214-78540236 TTCCCATGCTGTTATTGTGATGG - Intergenic
1193521049 X:82528962-82528984 TTCCCATGCTTTTAAAGTGGTGG - Intergenic
1193863442 X:86699522-86699544 CTCCCATACTGTTCTCATGGTGG - Intronic
1193950057 X:87786521-87786543 TTCCCATGGTGTTCTCACGGTGG - Intergenic
1194088950 X:89562776-89562798 TTCCCATGCTGTTCTCATGATGG - Intergenic
1194089209 X:89564724-89564746 TTCCCATGCTGTTCTCTTGATGG - Intergenic
1194220339 X:91182286-91182308 TTCCCATGCTATCCTCATGATGG + Intergenic
1194397408 X:93403249-93403271 TTCCCAGGATGTTCTCATGATGG - Intergenic
1195042713 X:101028810-101028832 TCCCCTTGCTGTTCTGGTGATGG + Intronic
1196503473 X:116412113-116412135 TTCCTGTGCTGTTCTTGTGATGG + Intergenic
1196565350 X:117197736-117197758 TTCCCATGATGTTCTTGTAATGG + Intergenic
1197483366 X:127014908-127014930 TCCCCATGCTGTTCTCATGATGG + Intergenic
1197642746 X:128985094-128985116 TTCCTGTGCTGTTCTTGTGGTGG + Intergenic
1198603004 X:138305031-138305053 TTCCCATGGTGTTCTCATGATGG - Intergenic
1198847175 X:140924697-140924719 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1199129216 X:144164706-144164728 TTTCCATGCTGTCCTCATGTTGG + Intergenic
1199147180 X:144381676-144381698 CCCCCATACTGTTCTCATGGTGG + Intergenic
1199182628 X:144876582-144876604 TTTCCTTGCTGTTCTCATGATGG - Intergenic
1199306322 X:146270711-146270733 CTCCCATGCTGTTCTTTTGATGG + Intergenic
1199458903 X:148060774-148060796 CACCCATACTGTTCTTGTGGTGG - Intergenic
1199580912 X:149358839-149358861 TTCCTGTGCTGTTCTTGTGATGG + Intergenic
1200441624 Y:3218833-3218855 TTCCCATGCTGTTCTCATGATGG - Intergenic
1200441874 Y:3220772-3220794 TTCCCATGCTGTTCTCTTGATGG - Intergenic
1200540839 Y:4453853-4453875 TTCCCATGTTTTTCTCATGATGG + Intergenic
1200556852 Y:4646038-4646060 TTCCCATGCTATCCTCATGATGG + Intergenic
1201236533 Y:11917228-11917250 TTCTTATGCTGTTCTTGTGATGG + Intergenic
1201921752 Y:19241191-19241213 TTTCCATGCTGTTCTTTTGATGG + Intergenic