ID: 966509631

View in Genome Browser
Species Human (GRCh38)
Location 3:180747482-180747504
Sequence TATTATGTGTAGTAAGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966509631_966509633 3 Left 966509631 3:180747482-180747504 CCTACCACTTACTACACATAATA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 966509633 3:180747508-180747530 AAGTCTCTTTCTTATGACTGAGG 0: 1
1: 0
2: 0
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966509631 Original CRISPR TATTATGTGTAGTAAGTGGT AGG (reversed) Intronic
900777605 1:4596349-4596371 TACTAAGTGTAGTAAGTCGGGGG - Intergenic
901565620 1:10112171-10112193 TATTATGTGAAGTAATTACTTGG + Intronic
907634530 1:56120296-56120318 TACTATGTGTACTAAGTTCTGGG - Intergenic
907982721 1:59500068-59500090 TATTCTGTCTAGTAAATGCTTGG + Intronic
910197972 1:84665317-84665339 TAGTATATTTAGTAAGTAGTAGG - Intronic
910654098 1:89602410-89602432 TCATATGGCTAGTAAGTGGTAGG + Intergenic
913487849 1:119350042-119350064 GATAATGTGTAGTAAGTTCTTGG - Intergenic
915992873 1:160533881-160533903 TTTTATATATAGTATGTGGTAGG + Intergenic
918126030 1:181584773-181584795 TATAATGTGGAGGAGGTGGTAGG - Intronic
918208499 1:182330361-182330383 TAAGATGTGTTGTAAGTGCTTGG + Intergenic
919848663 1:201657668-201657690 TATTGTGAGTATTAAGTGATGGG - Intronic
1063722257 10:8596104-8596126 TTTTATGAGAAGTAAGGGGTAGG - Intergenic
1068887061 10:62108785-62108807 TATTATGGGTGGCAAGTGGGGGG - Intergenic
1069088792 10:64174390-64174412 CATTATGTATAGTAAGTATTAGG + Intergenic
1071075007 10:81739518-81739540 AATTATGTGAAGAAAGTCGTTGG - Intergenic
1071858424 10:89648530-89648552 TATTGTGTGTACTATGTTGTAGG + Intergenic
1072894312 10:99353000-99353022 TTTTATGTATAGTATGAGGTAGG + Intronic
1073234419 10:102001656-102001678 TCTTATGTGTGGGAAGTGGAGGG - Intronic
1073790071 10:106931009-106931031 TATAATTTGTGGTAATTGGTGGG - Intronic
1074924781 10:118056870-118056892 TATTATGTGTATAAAATTGTAGG - Intergenic
1075149570 10:119914809-119914831 TATTGAGTGTGGTAAGTGTTGGG + Exonic
1075572131 10:123553758-123553780 TATTAAGTGTTGGAAGTGGGTGG - Intergenic
1075652527 10:124138341-124138363 TATTAAGGGTATTAAGTGGGTGG + Intergenic
1078820151 11:14871330-14871352 TTTTATTAGTAATAAGTGGTGGG - Exonic
1082631764 11:55551263-55551285 TTTTATCTGAAATAAGTGGTTGG + Intergenic
1086351605 11:85947481-85947503 TCTTATGTGTAGCAGGAGGTGGG + Intergenic
1089311892 11:117563660-117563682 CATTCAGTGTTGTAAGTGGTGGG + Intronic
1091187766 11:133661931-133661953 GATTCTGTGTAGTAAGTGCACGG + Intergenic
1092899622 12:13045986-13046008 TATTAGTTGTAGGAACTGGTTGG + Intronic
1094112095 12:26872825-26872847 TAATATGTATAATAGGTGGTTGG - Intergenic
1096949326 12:55449007-55449029 TAATATGTGTAGAAAGAGATGGG + Intergenic
1097415611 12:59312772-59312794 TTTTATGTATGGTGAGTGGTAGG - Intergenic
1100071681 12:90727977-90727999 TATTTTATGTAGTCAGTGTTTGG + Intergenic
1100323171 12:93516495-93516517 TATTATGTGTAGCTACAGGTAGG - Intergenic
1108146992 13:47488314-47488336 TATCATTTCTAGTAAGTGGCAGG - Intergenic
1109107742 13:58276649-58276671 TGTTAAGTGTATTCAGTGGTGGG + Intergenic
1112796956 13:103067682-103067704 GATTATGTGAAGAAAGTGGTCGG + Intergenic
1116084491 14:40217622-40217644 TATTCTGTAGAGTAAGTGATGGG + Intergenic
1118027621 14:61785751-61785773 TATTATTTGTATTAGGTGGAAGG - Intronic
1121699138 14:95938864-95938886 TTTTAGGGGTAGTAAGTGGTTGG + Intergenic
1129679513 15:77650333-77650355 TATTATGTGTCGAAAGGAGTGGG + Intronic
1131717299 15:95127060-95127082 TATTATATGTATTTATTGGTAGG + Intergenic
1133063682 16:3191465-3191487 TTTTATGTCTAGTAATTGGCGGG - Intergenic
1139103355 16:63796807-63796829 AATTAGGTGGAGTAATTGGTGGG - Intergenic
1145845419 17:28034342-28034364 TATAATGTGCAGGAAGTGGGAGG - Intergenic
1148085455 17:44991120-44991142 TATTGTGTGTGGTACCTGGTGGG + Intergenic
1149442604 17:56687511-56687533 TTTTATTTGTAGGAGGTGGTGGG - Intergenic
1151811092 17:76442452-76442474 TACTATTTGTAGTAAGTGGGAGG + Intronic
1152120786 17:78417050-78417072 TATTGTATGTACTAAGTGGAGGG - Intronic
1156436941 18:37142145-37142167 TTTTGTGTGTAGTATGAGGTAGG + Intronic
1156748240 18:40418632-40418654 TATTATGCTTAGTATGTGCTGGG - Intergenic
1157363356 18:47039807-47039829 TATTAGGGATAGTAATTGGTGGG - Intronic
1157539135 18:48486894-48486916 TATTATGAGGAGTAAGTGGGAGG + Intergenic
1160287586 18:77559246-77559268 TATTATGGTTAGTAAGTGCTAGG - Intergenic
1162400562 19:10444031-10444053 GATTATGTCAAGTAAGTAGTGGG + Intronic
1164009212 19:21183623-21183645 TCTTATGTGCAGTAAGTTGTGGG - Exonic
1164012807 19:21222061-21222083 TCTTATGTGCAGTAAGTTGGGGG + Intronic
1165684157 19:37803737-37803759 TATGATGTATAGTAAGTTGATGG - Intronic
925519116 2:4721575-4721597 TCTTATGGGTAGCAAGTAGTTGG + Intergenic
931170315 2:59796415-59796437 TTTTATTTGTAGTTTGTGGTGGG - Intergenic
932637848 2:73408236-73408258 CATTTTGTGAAGTAAGGGGTTGG - Intronic
936509751 2:113135630-113135652 TATTATTTGCATTTAGTGGTGGG - Intergenic
937961809 2:127465826-127465848 TATTATGTGTGGGAATTGTTTGG - Intronic
939472033 2:142634775-142634797 TCTTATGTGTAAAAAGTGGCCGG - Intergenic
942306705 2:174615271-174615293 TATTTTGTATAGGAAGTGGGAGG - Intronic
943651235 2:190459539-190459561 TATTGTGTCTTCTAAGTGGTTGG + Intronic
945119217 2:206441664-206441686 AATGATGTGTTGTAACTGGTGGG + Intergenic
945431352 2:209769830-209769852 TATTATATTTAGTTAATGGTAGG + Intergenic
946701602 2:222420444-222420466 GAATATGAGTAGTAAATGGTAGG - Intergenic
1169669460 20:8080095-8080117 AATTATTTTTTGTAAGTGGTGGG + Intergenic
1170065089 20:12302374-12302396 TATTCTCTATAGTAAATGGTTGG + Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1173398562 20:42703656-42703678 TTTTCTGTGTAGTAAATGGAAGG - Intronic
1175450027 20:59056738-59056760 TATTATGTGAAATAAATGGGTGG + Intergenic
955441861 3:58964632-58964654 AATTATTATTAGTAAGTGGTAGG - Intronic
956312837 3:67900789-67900811 TATTATGGTAAGTTAGTGGTTGG - Intergenic
957190137 3:76997395-76997417 TAATATGTGAAGTCAGTTGTGGG + Intronic
957270291 3:78021930-78021952 AACTATGTGCAGTAAGTGATGGG - Intergenic
957902317 3:86510832-86510854 TGTTATGTGAAGAAAGTGTTTGG - Intergenic
958753918 3:98227552-98227574 TATTTTGGGTATTAATTGGTCGG + Intergenic
959057838 3:101585749-101585771 TATTATGAGTAGTTTGTGCTAGG + Intronic
963944455 3:151130251-151130273 TGTTATGTGTAGTTATTGGATGG + Intronic
965296726 3:166956161-166956183 TATTAATTGTAGTCAGTGTTAGG - Intergenic
965457781 3:168925308-168925330 AATTATGTACAATAAGTGGTGGG - Intergenic
965797176 3:172451196-172451218 AACTATCTCTAGTAAGTGGTAGG + Intergenic
966509631 3:180747482-180747504 TATTATGTGTAGTAAGTGGTAGG - Intronic
966653674 3:182328966-182328988 TATTATCTGTTCTAGGTGGTAGG - Intergenic
970310142 4:14774080-14774102 TTTTATGTATGGTAAGAGGTAGG - Intergenic
971122734 4:23722368-23722390 TATTATGTCTACTAAGTGTAGGG + Intergenic
971533336 4:27716882-27716904 AATTTTGTGTAGGAAGTTGTGGG + Intergenic
972796738 4:42428777-42428799 TGTTATGTGTAGCAAGAGATGGG - Intronic
975215884 4:71753980-71754002 TGTCATGTGTAGCAAGTGGGTGG - Intronic
976618491 4:87102657-87102679 TATTCTGTCTAGAAACTGGTAGG - Intronic
980712459 4:136588592-136588614 TAATATGTTTAGTATCTGGTAGG - Intergenic
982685473 4:158483631-158483653 TGTTATGTTTGGGAAGTGGTGGG - Intronic
983892165 4:173041116-173041138 AATTCTGTTTAGTCAGTGGTGGG + Exonic
986616261 5:9620400-9620422 TATTATGTATAATATGTAGTGGG - Intergenic
987339301 5:16925129-16925151 TATTATTAATAGTAAGTGATAGG - Intronic
987779236 5:22411386-22411408 TAGTATGATTAGTAAATGGTAGG + Intronic
990197655 5:53336568-53336590 TATCATTTGCAGTAAGTGGTTGG + Intergenic
990499433 5:56381040-56381062 TATTATGTGTATCAAGGGATAGG + Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
995470385 5:112495682-112495704 TATTATGTGTTGAGAGTGGTAGG + Intergenic
997144333 5:131416193-131416215 GTTTATGTGTAGTATGAGGTAGG - Intergenic
998101683 5:139439872-139439894 TGTTCTGTGCAGTCAGTGGTAGG + Intronic
1000171854 5:158709910-158709932 CATTATGTGTATTTAGAGGTGGG + Intronic
1001226522 5:169949223-169949245 TACTATGTGCAGAATGTGGTAGG + Intronic
1001251907 5:170153032-170153054 TGGTGTGTGTAGTATGTGGTGGG + Intergenic
1003434959 6:6079682-6079704 TTTTGTGTGTAGGAAGAGGTAGG - Intergenic
1003885853 6:10520871-10520893 TCTTATGTTTAGTTATTGGTAGG - Intronic
1004571965 6:16854997-16855019 TATTGTGTGTACTAAGTGCCAGG - Intergenic
1004911013 6:20283996-20284018 ATTTTTGTGTAGTGAGTGGTAGG - Intergenic
1005209479 6:23443928-23443950 TCATATGTGTAGTAAGTGCTGGG + Intergenic
1006229438 6:32570534-32570556 AATTATTTGAAGTGAGTGGTTGG - Intronic
1010913916 6:81592105-81592127 TTTTATATGTAGTGAGAGGTAGG + Intronic
1011839869 6:91484041-91484063 TATTATTAGTAGTAAGTTTTTGG + Intergenic
1011880485 6:92017816-92017838 TATTGTGTCTAGTATGTGTTAGG - Intergenic
1012480585 6:99662591-99662613 TATTATGTGTTGTAAGGGGATGG + Intergenic
1012615120 6:101268425-101268447 TTTTTTGTGGAGTAAGTGCTGGG - Intergenic
1013928314 6:115500326-115500348 TTTTATGTGTAGTGTGAGGTTGG + Intergenic
1014473431 6:121843971-121843993 TACTATGTGCTGTAAGTTGTAGG - Intergenic
1015470885 6:133604906-133604928 TAATATGTATAGTACCTGGTAGG + Intergenic
1015584208 6:134758922-134758944 TATGAGGTGGAGTAAATGGTGGG + Intergenic
1016472815 6:144392398-144392420 TATTCTGTTTAATCAGTGGTGGG + Intronic
1020695287 7:11406415-11406437 TTTCTTGTGTAGTAAGTGATGGG - Exonic
1021254284 7:18371099-18371121 AATTATGTGTGGAAAGGGGTAGG + Intronic
1024838222 7:53549908-53549930 TGTTATGTGTAGTGTGAGGTAGG + Intergenic
1029142643 7:98422458-98422480 TATTTTTTTTAGTAAGTGGATGG - Intergenic
1031486667 7:122335102-122335124 TACTATGTGTAAAAAATGGTGGG - Intronic
1032552447 7:132797109-132797131 TATTTTGTGTAGAAAGTGCTGGG - Intronic
1035983357 8:4398206-4398228 GATGATCTGTAGTATGTGGTGGG + Intronic
1037124410 8:15328223-15328245 TTTAATGTGTGGTATGTGGTAGG + Intergenic
1038509709 8:28120714-28120736 TCTTATGTGTAATATGAGGTGGG + Intronic
1044205347 8:89486861-89486883 TATTATGTTTAGTAAGAGGCAGG - Intergenic
1045817806 8:106297328-106297350 TACTGTATTTAGTAAGTGGTAGG - Intronic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1046913591 8:119656407-119656429 TATTATGATTAGAATGTGGTGGG - Intronic
1048739034 8:137533652-137533674 TTTTATGTATAGAAAGTGTTTGG + Intergenic
1050202979 9:3168012-3168034 GATTTTATCTAGTAAGTGGTTGG + Intergenic
1050681269 9:8114511-8114533 TTGTTTGTGTAGTAAGTGGGTGG + Intergenic
1051544506 9:18259237-18259259 TAAGATGGGTAGTAGGTGGTTGG - Intergenic
1051938960 9:22481221-22481243 TTATTTGTGTAGTAAGTGGTTGG + Intergenic
1051959465 9:22740542-22740564 TTTTATTTGAAGCAAGTGGTAGG + Intergenic
1054337862 9:63823763-63823785 TACTGTGTGTAGTATGTGGGTGG - Intergenic
1055038850 9:71847106-71847128 TACTATGTGTAGTTACTGGCTGG + Intergenic
1055408989 9:76007444-76007466 AATTGTGTGTAGAAAGAGGTGGG + Intronic
1058530916 9:105903732-105903754 AATTTTGGGTGGTAAGTGGTAGG + Intergenic
1058718588 9:107743232-107743254 TATTATCTGTATTAATTGATAGG - Intergenic
1060129131 9:121077962-121077984 TAGTATGTATAGTACGTAGTTGG - Intronic
1185833878 X:3327542-3327564 TCTTATGTGTAGAAAGAGGCAGG - Intronic
1186299210 X:8180882-8180904 TCTTATGACTAGTAAGAGGTTGG - Intergenic
1187796477 X:23008958-23008980 TATTATATATAGTAGGTGATGGG - Intergenic
1187807232 X:23133965-23133987 TATTCTGTGTAATAAATGGATGG - Intergenic
1190377354 X:49802065-49802087 TTTTATGTGTAGTATTTAGTAGG - Intergenic
1193044635 X:77039206-77039228 TATTCTGTGAAGAAAGTCGTTGG - Intergenic
1193473173 X:81931566-81931588 TATTATGTGAAGCAAGTTATTGG + Intergenic
1195735027 X:108003483-108003505 TATTTTGTGCAGTTAGTGGATGG - Intergenic
1196182989 X:112715429-112715451 TCATATGGGTAGTGAGTGGTGGG + Intergenic
1198972710 X:142299245-142299267 TGTTATGTGTAATAGGTGTTGGG - Intergenic